EMAIL THIS PAGE TO A FRIEND

RPL22L1

ribosomal protein L22-like 1

40 Gene Product Result for
UniProtKB ID: Q6P5R6, Q32Q77
Gene ID:
Mouse(68028) ribosomal protein L22 like 1
Rat(361923) ribosomal protein L22 like 1
cow(614872) ribosomal protein L22-like 1
sheep(101117207) ribosomal protein L22-like 1
domestic guinea pig(100733378) ribosomal protein L22-like 1
naked mole-rat(101696766) ribosomal protein L22-like 1
Zebrafish(735250) ribosomal protein L22-like 1
chicken(100858296) ribosomal protein L22-like 1
domestic cat(101086248) ribosomal protein L22-like 1
dog(488163) ribosomal protein L22-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099645 Rosetta Predictions human pricing
NM_001108548 Rosetta Predictions rat pricing
NM_026517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320853 predicted 344
2 SASI_Hs02_00320854 predicted 399
3 SASI_Hs02_00320855 predicted 497
4 SASI_Hs02_00320856 predicted 430
5 SASI_Hs02_00320857 predicted 205
6 SASI_Hs02_00320858 predicted 396
7 SASI_Hs02_00320859 predicted 140
8 SASI_Hs02_00320860 predicted 650
9 SASI_Hs02_00320861 predicted 587
10 SASI_Hs02_00320862 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239729 predicted 270
2 SASI_Rn02_00239730 predicted 271
3 SASI_Rn02_00239731 predicted 261
4 SASI_Rn02_00239732 predicted 255
5 SASI_Rn02_00239733 predicted 251
6 SASI_Rn02_00239734 predicted 253
7 SASI_Rn02_00239735 predicted 266
8 SASI_Rn02_00239736 predicted 207
9 SASI_Rn02_00239737 predicted 256
10 SASI_Rn02_00239738 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129562 predicted 210
2 SASI_Mm01_00129563 predicted 220
3 SASI_Mm01_00129564 predicted 252
4 SASI_Mm01_00129566 predicted 250
5 SASI_Mm01_00129567 predicted 217
6 SASI_Mm01_00129570 predicted 226
7 SASI_Mm01_00129571 predicted 264
8 SASI_Mm02_00330424 predicted 325
9 SASI_Mm02_00330425 predicted 329
10 SASI_Mm02_00330426 predicted 125
11 SASI_Mm01_00129565 predicted 216
12 SASI_Mm01_00129568 predicted 225
13 SASI_Mm01_00129569 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026517
VALIDATED
RPL22L1 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L22-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-315s21c1
Sequence:CCGGCGCATCTGACAAGGAGACTTACTCGAGTAAGTCTCCTTGTCAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-139s21c1
Sequence:CCGGCGGGAGAAGGTTAAAGTCAATCTCGAGATTGACTTTAACCTTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-326s21c1
Sequence:CCGGAGGAGACTTACGAACTTCGTTCTCGAGAACGAAGTTCGTAAGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-228s1c1
Sequence:CCGGTCTGAGAAACAGTTCTCCAAACTCGAGTTTGGAGAACTGTTTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026517.1-192s1c1
Sequence:CCGGCACATTGAACGCCTGAAGAATCTCGAGATTCTTCAGGCGTTCAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-317s1c1
Sequence:CCGGCGCATCTGACAAGGAGACTTACTCGAGTAAGTCTCCTTGTCAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-141s1c1
Sequence:CCGGCGGGAGAAGGTTAAAGTCAATCTCGAGATTGACTTTAACCTTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-226s21c1
Sequence:CCGGTCTGAGAAACAGTTCTCCAAACTCGAGTTTGGAGAACTGTTTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-328s1c1
Sequence:CCGGAGGAGACTTACGAACTTCGTTCTCGAGAACGAAGTTCGTAAGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026517
VALIDATED
RPL22L1 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L22-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-315s21c1
Sequence:CCGGCGCATCTGACAAGGAGACTTACTCGAGTAAGTCTCCTTGTCAGATGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000332386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-139s21c1
Sequence:CCGGCGGGAGAAGGTTAAAGTCAATCTCGAGATTGACTTTAACCTTCTCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000332314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-326s21c1
Sequence:CCGGAGGAGACTTACGAACTTCGTTCTCGAGAACGAAGTTCGTAAGTCTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000104325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-228s1c1
Sequence:CCGGTCTGAGAAACAGTTCTCCAAACTCGAGTTTGGAGAACTGTTTCTCAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000104326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026517.1-192s1c1
Sequence:CCGGCACATTGAACGCCTGAAGAATCTCGAGATTCTTCAGGCGTTCAATGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000104327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-317s1c1
Sequence:CCGGCGCATCTGACAAGGAGACTTACTCGAGTAAGTCTCCTTGTCAGATGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000104328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-141s1c1
Sequence:CCGGCGGGAGAAGGTTAAAGTCAATCTCGAGATTGACTTTAACCTTCTCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000332385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-226s21c1
Sequence:CCGGTCTGAGAAACAGTTCTCCAAACTCGAGTTTGGAGAACTGTTTCTCAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000104329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-328s1c1
Sequence:CCGGAGGAGACTTACGAACTTCGTTCTCGAGAACGAAGTTCGTAAGTCTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026517
VALIDATED
RPL22L1 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L22-like 1
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000354138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-315s21c1
Sequence:CCGGCGCATCTGACAAGGAGACTTACTCGAGTAAGTCTCCTTGTCAGATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-139s21c1
Sequence:CCGGCGGGAGAAGGTTAAAGTCAATCTCGAGATTGACTTTAACCTTCTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-326s21c1
Sequence:CCGGAGGAGACTTACGAACTTCGTTCTCGAGAACGAAGTTCGTAAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-228s1c1
Sequence:CCGGTCTGAGAAACAGTTCTCCAAACTCGAGTTTGGAGAACTGTTTCTCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026517.1-192s1c1
Sequence:CCGGCACATTGAACGCCTGAAGAATCTCGAGATTCTTCAGGCGTTCAATGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-317s1c1
Sequence:CCGGCGCATCTGACAAGGAGACTTACTCGAGTAAGTCTCCTTGTCAGATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-141s1c1
Sequence:CCGGCGGGAGAAGGTTAAAGTCAATCTCGAGATTGACTTTAACCTTCTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026517.2-226s21c1
Sequence:CCGGTCTGAGAAACAGTTCTCCAAACTCGAGTTTGGAGAACTGTTTCTCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026517.1-328s1c1
Sequence:CCGGAGGAGACTTACGAACTTCGTTCTCGAGAACGAAGTTCGTAAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099645
VALIDATED
RPL22L1 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L22-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099645.1-1379s21c1
Sequence:CCGGGGACCCTTTCTCCCGAATAAACTCGAGTTTATTCGGGAGAAAGGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099645.1-327s21c1
Sequence:CCGGCTTACCAAGAAATACCTTAAGCTCGAGCTTAAGGTATTTCTTGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-199s21c1
Sequence:CCGGTTCTACGGGAGAAGGTTAAAGCTCGAGCTTTAACCTTCTCCCGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-119s21c1
Sequence:CCGGGAGGTCAACCTGGAGGTTTAACTCGAGTTAAACCTCCAGGTTGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-257s21c1
Sequence:CCGGCATTGAACGCTTCAAGAATAACTCGAGTTATTCTTGAAGCGTTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099645
VALIDATED
RPL22L1 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L22-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099645.1-1379s21c1
Sequence:CCGGGGACCCTTTCTCCCGAATAAACTCGAGTTTATTCGGGAGAAAGGGTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099645.1-327s21c1
Sequence:CCGGCTTACCAAGAAATACCTTAAGCTCGAGCTTAAGGTATTTCTTGGTAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-199s21c1
Sequence:CCGGTTCTACGGGAGAAGGTTAAAGCTCGAGCTTTAACCTTCTCCCGTAGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-119s21c1
Sequence:CCGGGAGGTCAACCTGGAGGTTTAACTCGAGTTAAACCTCCAGGTTGACCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-257s21c1
Sequence:CCGGCATTGAACGCTTCAAGAATAACTCGAGTTATTCTTGAAGCGTTCAATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099645
VALIDATED
RPL22L1 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L22-like 1
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000247706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099645.1-1379s21c1
Sequence:CCGGGGACCCTTTCTCCCGAATAAACTCGAGTTTATTCGGGAGAAAGGGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099645.1-327s21c1
Sequence:CCGGCTTACCAAGAAATACCTTAAGCTCGAGCTTAAGGTATTTCTTGGTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-199s21c1
Sequence:CCGGTTCTACGGGAGAAGGTTAAAGCTCGAGCTTTAACCTTCTCCCGTAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-119s21c1
Sequence:CCGGGAGGTCAACCTGGAGGTTTAACTCGAGTTAAACCTCCAGGTTGACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099645.1-257s21c1
Sequence:CCGGCATTGAACGCTTCAAGAATAACTCGAGTTATTCTTGAAGCGTTCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)