EMAIL THIS PAGE TO A FRIEND

RPL23A

ribosomal protein L23a

29 Gene Product Result for
Synonyms: L23A MDA20
UniProtKB ID: P62750, B2R5B2, P29316, P39024, Q92774
Gene ID:
Human(6147) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins. It is located in the cytoplasm. The protein may be one of the target molecules involved in mediating growth inhibition by interferon. In yeast, the corresponding protein binds to a specific site on the 26S rRNA. This gene is co-transcribed with the U42A, U42B, U101A, and U101B small nucleolar RNA genes, which are located in its third, first, second, and fourth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(268449) ribosomal protein L23A
Rat(360572) ribosomal protein L23a
cow(507168) ribosomal protein L23a
sheep(100415774) ribosomal protein L23a
naked mole-rat(101715285) ribosomal protein L23a
Domestic Rabbit(100568446) ribosomal protein L23a
domestic guinea pig(100723728) ribosomal protein L23a
fruit fly(38208) Ribosomal protein L23A
Zebrafish(335539) ribosomal protein L23a
chicken(417574) ribosomal protein L23a
domestic cat(101096618) ribosomal protein L23a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_193624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_193624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_193624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216711 MISSION® esiRNA esiRNA targeting mouse Rpl23a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000984 Rosetta Predictions human pricing
NM_001108283 Rosetta Predictions rat pricing
NM_207523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231731 predicted 673
2 SASI_Hs02_00303653 predicted 703
3 SASI_Hs02_00303654 predicted 683
4 SASI_Hs02_00303655 predicted 692
5 SASI_Hs01_00231729 predicted 755
6 SASI_Hs02_00303656 predicted 618
7 SASI_Hs01_00231730 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237134 predicted 311
2 SASI_Rn02_00237135 predicted 310
3 SASI_Rn02_00237136 predicted 393
4 SASI_Rn02_00237137 predicted 447
5 SASI_Rn02_00237138 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352059 predicted 212
2 SASI_Mm02_00352060 predicted 213
3 SASI_Mm02_00352061 predicted 270
4 SASI_Mm02_00352062 predicted 197
5 SASI_Mm02_00352063 predicted 205
6 SASI_Mm02_00352064 predicted 272
7 SASI_Mm02_00352065 predicted 208
8 SASI_Mm02_00352066 predicted 205
9 SASI_Mm02_00352067 predicted 205
10 SASI_Mm02_00352068 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000984
VALIDATED
RPL23A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L23a
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-828s21c1
Sequence:CCGGAGGGTGTTAGCATCCATTTCACTCGAGTGAAATGGATGCTAACACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-680s21c1
Sequence:CCGGTGATCATTCCAGAGATCTTTGCTCGAGCAAAGATCTCTGGAATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-741s21c1
Sequence:CCGGTTGCCTCCATGGTTGAGTAACCTCGAGGTTACTCAACCATGGAGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-615s1c1
Sequence:CCGGGCTGCCTAATTCTGAATATATCTCGAGATATATTCAGAATTAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-443s1c1
Sequence:CCGGGCCAACAAGCACCAGATTAAACTCGAGTTTAATCTGGTGCTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-569s1c1
Sequence:CCGGGCTTTGGATGTTGCCAACAAACTCGAGTTTGTTGGCAACATCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-167s1c1
Sequence:CCGGCCTCCTAAAGCTGAAGCCAAACTCGAGTTTGGCTTCAGCTTTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-349s1c1
Sequence:CCGGCCACTATGCTATCATCAAGTTCTCGAGAACTTGATGATAGCATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-553s21c1
Sequence:CCGGCATGCCTGTCTGTCAATTTCTCTCGAGAGAAATTGACAGACAGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-864s21c1
Sequence:CCGGGCTGGCTCTCTGGTAGCATTTCTCGAGAAATGCTACCAGAGAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000984
VALIDATED
RPL23A MISSION shRNA shRNA Plasmid DNA
ribosomal protein L23a
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-828s21c1
Sequence:CCGGAGGGTGTTAGCATCCATTTCACTCGAGTGAAATGGATGCTAACACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-680s21c1
Sequence:CCGGTGATCATTCCAGAGATCTTTGCTCGAGCAAAGATCTCTGGAATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-741s21c1
Sequence:CCGGTTGCCTCCATGGTTGAGTAACCTCGAGGTTACTCAACCATGGAGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-615s1c1
Sequence:CCGGGCTGCCTAATTCTGAATATATCTCGAGATATATTCAGAATTAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-443s1c1
Sequence:CCGGGCCAACAAGCACCAGATTAAACTCGAGTTTAATCTGGTGCTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-569s1c1
Sequence:CCGGGCTTTGGATGTTGCCAACAAACTCGAGTTTGTTGGCAACATCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-167s1c1
Sequence:CCGGCCTCCTAAAGCTGAAGCCAAACTCGAGTTTGGCTTCAGCTTTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-349s1c1
Sequence:CCGGCCACTATGCTATCATCAAGTTCTCGAGAACTTGATGATAGCATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-553s21c1
Sequence:CCGGCATGCCTGTCTGTCAATTTCTCTCGAGAGAAATTGACAGACAGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-864s21c1
Sequence:CCGGGCTGGCTCTCTGGTAGCATTTCTCGAGAAATGCTACCAGAGAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000984
VALIDATED
RPL23A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L23a
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-828s21c1
Sequence:CCGGAGGGTGTTAGCATCCATTTCACTCGAGTGAAATGGATGCTAACACCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-680s21c1
Sequence:CCGGTGATCATTCCAGAGATCTTTGCTCGAGCAAAGATCTCTGGAATGATCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-741s21c1
Sequence:CCGGTTGCCTCCATGGTTGAGTAACCTCGAGGTTACTCAACCATGGAGGCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-615s1c1
Sequence:CCGGGCTGCCTAATTCTGAATATATCTCGAGATATATTCAGAATTAGGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-443s1c1
Sequence:CCGGGCCAACAAGCACCAGATTAAACTCGAGTTTAATCTGGTGCTTGTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-569s1c1
Sequence:CCGGGCTTTGGATGTTGCCAACAAACTCGAGTTTGTTGGCAACATCCAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-167s1c1
Sequence:CCGGCCTCCTAAAGCTGAAGCCAAACTCGAGTTTGGCTTCAGCTTTAGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000984.4-349s1c1
Sequence:CCGGCCACTATGCTATCATCAAGTTCTCGAGAACTTGATGATAGCATAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-553s21c1
Sequence:CCGGCATGCCTGTCTGTCAATTTCTCTCGAGAGAAATTGACAGACAGGCATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000984.5-864s21c1
Sequence:CCGGGCTGGCTCTCTGGTAGCATTTCTCGAGAAATGCTACCAGAGAGCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_193624
VALIDATED
RPL23A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L23a
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-216s1c1
Sequence:CCGGCCACTATGCTATCATCAAATTCTCGAGAATTTGATGATAGCATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-365s1c1
Sequence:CCGGCCAAAGTCAATACCCTGATAACTCGAGTTATCAGGGTATTGACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-213s1c1
Sequence:CCGGTGACCACTATGCTATCATCAACTCGAGTTGATGATAGCATAGTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-310s1c1
Sequence:CCGGGCCAATAAGCATCAGATCAAACTCGAGTTTGATCTGATGCTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-321s1c1
Sequence:CCGGTCAGATCAAACAGGCTGTCAACTCGAGTTGACAGCCTGTTTGATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_193624
VALIDATED
RPL23A MISSION shRNA shRNA Plasmid DNA
ribosomal protein L23a
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-216s1c1
Sequence:CCGGCCACTATGCTATCATCAAATTCTCGAGAATTTGATGATAGCATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-365s1c1
Sequence:CCGGCCAAAGTCAATACCCTGATAACTCGAGTTATCAGGGTATTGACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-213s1c1
Sequence:CCGGTGACCACTATGCTATCATCAACTCGAGTTGATGATAGCATAGTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-310s1c1
Sequence:CCGGGCCAATAAGCATCAGATCAAACTCGAGTTTGATCTGATGCTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-321s1c1
Sequence:CCGGTCAGATCAAACAGGCTGTCAACTCGAGTTGACAGCCTGTTTGATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_193624
VALIDATED
RPL23A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L23a
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-216s1c1
Sequence:CCGGCCACTATGCTATCATCAAATTCTCGAGAATTTGATGATAGCATAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-365s1c1
Sequence:CCGGCCAAAGTCAATACCCTGATAACTCGAGTTATCAGGGTATTGACTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-213s1c1
Sequence:CCGGTGACCACTATGCTATCATCAACTCGAGTTGATGATAGCATAGTGGTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-310s1c1
Sequence:CCGGGCCAATAAGCATCAGATCAAACTCGAGTTTGATCTGATGCTTATTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_193624.2-321s1c1
Sequence:CCGGTCAGATCAAACAGGCTGTCAACTCGAGTTGACAGCCTGTTTGATCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???