EMAIL THIS PAGE TO A FRIEND

RPL37A

ribosomal protein L37a

25 Gene Product Result for
Synonyms: L37A
UniProtKB ID: P61513, P12751, Q6FGF5
Gene ID:
Human(6168) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L37AE family of ribosomal proteins. It is located in the cytoplasm. The protein contains a C4-type zinc finger-like domain. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(19981) ribosomal protein L37a
Rat(100361520) ribosomal protein L37a
cow(504413) ribosomal protein L37a
sheep(101109155) ribosomal protein L37a
naked mole-rat(100913080) 60S ribosomal protein L37a
fruit fly(44783) Ribosomal protein L37A
fruit fly(32446) Ribosomal protein L37a
domestic cat(101084046) ribosomal protein L37a
dog(478904) ribosomal protein L37a
chicken(769981) ribosomal protein L37a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104729 Anti-RPL37A antibody produced in rabbit affinity isolated antibody mouse, horse, rat, guinea pig, dog, human, bovine, rabbit
western blot pricing
SAB4502670 Anti-RPL37A antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
HPA065327 Anti-RPL37A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000998 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109641 MISSION® esiRNA esiRNA human RPL37A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000998 Rosetta Predictions human pricing
NM_009084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082070 predicted 242
2 SASI_Hs01_00082071 predicted 239
3 SASI_Hs02_00303700 predicted 245
4 SASI_Hs01_00082072 predicted 292
5 SASI_Hs01_00082073 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149265 predicted 393
2 SASI_Mm01_00149257 predicted 155
3 SASI_Mm01_00149258 predicted 147
4 SASI_Mm01_00149259 predicted 63
5 SASI_Mm01_00149260 predicted 175
6 SASI_Mm01_00149261 predicted 158
7 SASI_Mm01_00149262 predicted 205
8 SASI_Mm01_00149263 predicted 288
9 SASI_Mm01_00149264 predicted 327
10 SASI_Mm01_00149266 predicted 193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000998
VALIDATED
RPL37A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L37a
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000998.3-228s1c1
Sequence:CCGGGCGGTGCCTGGACGTACAATACTCGAGTATTGTACGTCCAGGCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000998.3-593s1c1
Sequence:CCGGGCCAACTGTAAACTTTAGTTTCTCGAGAAACTAAAGTTTACAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-196s1c1
Sequence:CCGGGCACTGTGGTTCCTGCATGAACTCGAGTTCATGCAGGAACCACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-276s1c1
Sequence:CCGGCCATCAGAAGACTGAAGGAGTCTCGAGACTCCTTCAGTCTTCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-133s1c1
Sequence:CCGGCGCCAAGTACACTTGCTCTTTCTCGAGAAAGAGCAAGTGTACTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-165s21c1
Sequence:CCGGTGAAATCAGCCAGCACGCCAACTCGAGTTGGCGTGCTGGCTGATTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-180s21c1
Sequence:CCGGCGCCAAGTACACTTGCTCTTTCTCGAGAAAGAGCAAGTGTACTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-243s21c1
Sequence:CCGGGCACTGTGGTTCCTGCATGAACTCGAGTTCATGCAGGAACCACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-105s21c1
Sequence:CCGGGATCGTCGGTAAATACGGGACCTCGAGGTCCCGTATTTACCGACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-323s21c1
Sequence:CCGGCCATCAGAAGACTGAAGGAGTCTCGAGACTCCTTCAGTCTTCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000998
VALIDATED
RPL37A MISSION shRNA shRNA Plasmid DNA
ribosomal protein L37a
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000998.3-228s1c1
Sequence:CCGGGCGGTGCCTGGACGTACAATACTCGAGTATTGTACGTCCAGGCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000998.3-593s1c1
Sequence:CCGGGCCAACTGTAAACTTTAGTTTCTCGAGAAACTAAAGTTTACAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-196s1c1
Sequence:CCGGGCACTGTGGTTCCTGCATGAACTCGAGTTCATGCAGGAACCACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-276s1c1
Sequence:CCGGCCATCAGAAGACTGAAGGAGTCTCGAGACTCCTTCAGTCTTCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-133s1c1
Sequence:CCGGCGCCAAGTACACTTGCTCTTTCTCGAGAAAGAGCAAGTGTACTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-165s21c1
Sequence:CCGGTGAAATCAGCCAGCACGCCAACTCGAGTTGGCGTGCTGGCTGATTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-180s21c1
Sequence:CCGGCGCCAAGTACACTTGCTCTTTCTCGAGAAAGAGCAAGTGTACTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-243s21c1
Sequence:CCGGGCACTGTGGTTCCTGCATGAACTCGAGTTCATGCAGGAACCACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-105s21c1
Sequence:CCGGGATCGTCGGTAAATACGGGACCTCGAGGTCCCGTATTTACCGACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-323s21c1
Sequence:CCGGCCATCAGAAGACTGAAGGAGTCTCGAGACTCCTTCAGTCTTCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000998
VALIDATED
RPL37A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L37a
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000998.3-228s1c1
Sequence:CCGGGCGGTGCCTGGACGTACAATACTCGAGTATTGTACGTCCAGGCACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000998.3-593s1c1
Sequence:CCGGGCCAACTGTAAACTTTAGTTTCTCGAGAAACTAAAGTTTACAGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-196s1c1
Sequence:CCGGGCACTGTGGTTCCTGCATGAACTCGAGTTCATGCAGGAACCACAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-276s1c1
Sequence:CCGGCCATCAGAAGACTGAAGGAGTCTCGAGACTCCTTCAGTCTTCTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000998.3-133s1c1
Sequence:CCGGCGCCAAGTACACTTGCTCTTTCTCGAGAAAGAGCAAGTGTACTTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-165s21c1
Sequence:CCGGTGAAATCAGCCAGCACGCCAACTCGAGTTGGCGTGCTGGCTGATTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-180s21c1
Sequence:CCGGCGCCAAGTACACTTGCTCTTTCTCGAGAAAGAGCAAGTGTACTTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-243s21c1
Sequence:CCGGGCACTGTGGTTCCTGCATGAACTCGAGTTCATGCAGGAACCACAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-105s21c1
Sequence:CCGGGATCGTCGGTAAATACGGGACCTCGAGGTCCCGTATTTACCGACGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000998.4-323s21c1
Sequence:CCGGCCATCAGAAGACTGAAGGAGTCTCGAGACTCCTTCAGTCTTCTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009084
VALIDATED
RPL37A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L37a
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-143s1c1
Sequence:CCGGCACTTGCTCCTTCTGTGGCAACTCGAGTTGCCACAGAAGGAGCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-136s1c1
Sequence:CCGGCCAAGTACACTTGCTCCTTCTCTCGAGAGAAGGAGCAAGTGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-276s1c1
Sequence:CCGGGCCATCAGAAGACTGAAGGAACTCGAGTTCCTTCAGTCTTCTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009084.2-265s1c1
Sequence:CCGGCAGTGAAGTCTGCCATCAGAACTCGAGTTCTGATGGCAGACTTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-65s1c1
Sequence:CCGGCGGCAAGTACGGGACCCGCTACTCGAGTAGCGGGTCCCGTACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009084
VALIDATED
RPL37A MISSION shRNA shRNA Plasmid DNA
ribosomal protein L37a
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-143s1c1
Sequence:CCGGCACTTGCTCCTTCTGTGGCAACTCGAGTTGCCACAGAAGGAGCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-136s1c1
Sequence:CCGGCCAAGTACACTTGCTCCTTCTCTCGAGAGAAGGAGCAAGTGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-276s1c1
Sequence:CCGGGCCATCAGAAGACTGAAGGAACTCGAGTTCCTTCAGTCTTCTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009084.2-265s1c1
Sequence:CCGGCAGTGAAGTCTGCCATCAGAACTCGAGTTCTGATGGCAGACTTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-65s1c1
Sequence:CCGGCGGCAAGTACGGGACCCGCTACTCGAGTAGCGGGTCCCGTACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009084
VALIDATED
RPL37A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L37a
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-143s1c1
Sequence:CCGGCACTTGCTCCTTCTGTGGCAACTCGAGTTGCCACAGAAGGAGCAAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-136s1c1
Sequence:CCGGCCAAGTACACTTGCTCCTTCTCTCGAGAGAAGGAGCAAGTGTACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-276s1c1
Sequence:CCGGGCCATCAGAAGACTGAAGGAACTCGAGTTCCTTCAGTCTTCTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009084.2-265s1c1
Sequence:CCGGCAGTGAAGTCTGCCATCAGAACTCGAGTTCTGATGGCAGACTTCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009084.2-65s1c1
Sequence:CCGGCGGCAAGTACGGGACCCGCTACTCGAGTAGCGGGTCCCGTACTTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)