EMAIL THIS PAGE TO A FRIEND

RPP14

ribonuclease P/MRP 14kDa subunit

121 Gene Product Result for
Synonyms: P14
UniProtKB ID: O95059, Q53X97
Gene ID:
Mouse(67053) ribonuclease P 14 subunit
Rat(361020) ribonuclease P/MRP 14 subunit
Zebrafish(553721) ribonuclease P 14 subunit
dog(612771) ribonuclease P/MRP 14kDa subunit
domestic cat(101099867) ribonuclease P/MRP 14kDa subunit
chicken(416064) ribonuclease P/MRP 14kDa subunit
domestic guinea pig(100732910) ribonuclease P/MRP 14kDa subunit
naked mole-rat(101713673) ribonuclease P/MRP 14kDa subunit
cow(515208) ribonuclease P/MRP 14kDa subunit
sheep(101122389) ribonuclease P/MRP 14kDa subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007042 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003931 MISSION® esiRNA esiRNA targeting human RPP14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098783 Rosetta Predictions human pricing
NM_007042 Rosetta Predictions human pricing
NM_001108372 Rosetta Predictions rat pricing
NM_025938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319789 predicted 777
2 SASI_Hs02_00319790 predicted 772
3 SASI_Hs02_00319791 predicted 788
4 SASI_Hs02_00319792 predicted 735
5 SASI_Hs02_00319793 predicted 732
6 SASI_Hs02_00319794 predicted 1109
7 SASI_Hs02_00319795 predicted 1040
8 SASI_Hs02_00319796 predicted 688
9 SASI_Hs02_00319797 predicted 1097
10 SASI_Hs02_00319798 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089571 predicted 545
2 SASI_Hs01_00089572 predicted 534
3 SASI_Hs01_00089573 predicted 550
4 SASI_Hs01_00089574 predicted 498
5 SASI_Hs01_00089576 predicted 499
6 SASI_Hs02_00342826 predicted 878
7 SASI_Hs02_00342827 predicted 804
8 SASI_Hs01_00089578 predicted 455
9 SASI_Hs02_00342828 predicted 863
10 SASI_Hs02_00342829 predicted 585
11 SASI_Hs01_00089575 predicted 271
12 SASI_Hs01_00089577 predicted 238
13 SASI_Hs01_00089579 predicted 275
14 SASI_Hs01_00089580 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238019 predicted 1342
2 SASI_Rn02_00238020 predicted 973
3 SASI_Rn02_00238021 predicted 1045
4 SASI_Rn02_00238022 predicted 1300
5 SASI_Rn02_00238023 predicted 883
6 SASI_Rn02_00238024 predicted 1208
7 SASI_Rn02_00238025 predicted 1314
8 SASI_Rn02_00238026 predicted 1253
9 SASI_Rn02_00238027 predicted 996
10 SASI_Rn02_00238028 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152504 predicted 770
2 SASI_Mm01_00152505 predicted 420
3 SASI_Mm02_00329325 predicted 224
4 SASI_Mm01_00152506 predicted 683
5 SASI_Mm01_00152507 predicted 666
6 SASI_Mm01_00152508 predicted 503
7 SASI_Mm01_00152509 predicted 502
8 SASI_Mm01_00152510 predicted 250
9 SASI_Mm01_00152511 predicted 480
10 SASI_Mm01_00152512 predicted 515
11 SASI_Mm01_00152513 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007042
RPP14 MISSION shRNA Bacterial Glycerol Stock
ribonuclease P/MRP 14kDa subunit
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000049895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-522s1c1
Sequence:CCGGGTAGGGAACTAGTATTGGATTCTCGAGAATCCAATACTAGTTCCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-341s1c1
Sequence:CCGGGCCTTACCTTTGGACATCCTACTCGAGTAGGATGTCCAAAGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-347s1c1
Sequence:CCGGCCTTTGGACATCCTAACCTATCTCGAGATAGGTTAGGATGTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-295s1c1
Sequence:CCGGGCTGCTTATTTCGGCTGTGAACTCGAGTTCACAGCCGAAATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007042
RPP14 MISSION shRNA shRNA Plasmid DNA
ribonuclease P/MRP 14kDa subunit
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000049895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-522s1c1
Sequence:CCGGGTAGGGAACTAGTATTGGATTCTCGAGAATCCAATACTAGTTCCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-341s1c1
Sequence:CCGGGCCTTACCTTTGGACATCCTACTCGAGTAGGATGTCCAAAGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-347s1c1
Sequence:CCGGCCTTTGGACATCCTAACCTATCTCGAGATAGGTTAGGATGTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-295s1c1
Sequence:CCGGGCTGCTTATTTCGGCTGTGAACTCGAGTTCACAGCCGAAATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007042
RPP14 MISSION shRNA Lentiviral Transduction Particles
ribonuclease P/MRP 14kDa subunit
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000049895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-522s1c1
Sequence:CCGGGTAGGGAACTAGTATTGGATTCTCGAGAATCCAATACTAGTTCCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-341s1c1
Sequence:CCGGGCCTTACCTTTGGACATCCTACTCGAGTAGGATGTCCAAAGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-347s1c1
Sequence:CCGGCCTTTGGACATCCTAACCTATCTCGAGATAGGTTAGGATGTCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007042.1-295s1c1
Sequence:CCGGGCTGCTTATTTCGGCTGTGAACTCGAGTTCACAGCCGAAATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025938
VALIDATED
RPP14 MISSION shRNA Bacterial Glycerol Stock
ribonuclease P/MRP 14kDa subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025938.4-625s21c1
Sequence:CCGGTCCTTAGGTGTCTACATTATTCTCGAGAATAATGTAGACACCTAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025938.1-1397s1c1
Sequence:CCGGCCAGAGTATCTGGGTTCAATTCTCGAGAATTGAACCCAGATACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025938.1-220s1c1
Sequence:CCGGCATGAAAGTCTGTCTAGAGTTCTCGAGAACTCTAGACAGACTTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025938.1-402s1c1
Sequence:CCGGTGGTCAAATTATGGAGTTCTTCTCGAGAAGAACTCCATAATTTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025938.1-424s1c1
Sequence:CCGGGACCTTGTTTGGAGCCTATAACTCGAGTTATAGGCTCCAAACAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025938.1-500s1c1
Sequence:CCGGTCTGGCAATAGCAGGGAACAACTCGAGTTGTTCCCTGCTATTGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025938.4-273s21c1
Sequence:CCGGCATGAAAGTCTGTCTAGAGTTCTCGAGAACTCTAGACAGACTTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025938.4-422s21c1
Sequence:CCGGTGTCGGCCATCTTGAGAATATCTCGAGATATTCTCAAGATGGCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025938.4-506s21c1
Sequence:CCGGAGTGTGCCTTCAGAGTGATTCCTCGAGGAATCACTCTGAAGGCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025938.4-477s21c1
Sequence:CCGGGACCTTGTTTGGAGCCTATAACTCGAGTTATAGGCTCCAAACAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025938
VALIDATED
RPP14 MISSION shRNA shRNA Plasmid DNA
ribonuclease P/MRP 14kDa subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025938.4-625s21c1
Sequence:CCGGTCCTTAGGTGTCTACATTATTCTCGAGAATAATGTAGACACCTAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025938.1-1397s1c1
Sequence:CCGGCCAGAGTATCTGGGTTCAATTCTCGAGAATTGAACCCAGATACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025938.1-220s1c1
Sequence:CCGGCATGAAAGTCTGTCTAGAGTTCTCGAGAACTCTAGACAGACTTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025938.1-402s1c1
Sequence:CCGGTGGTCAAATTATGGAGTTCTTCTCGAGAAGAACTCCATAATTTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025938.1-424s1c1
Sequence:CCGGGACCTTGTTTGGAGCCTATAACTCGAGTTATAGGCTCCAAACAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025938.1-500s1c1
Sequence:CCGGTCTGGCAATAGCAGGGAACAACTCGAGTTGTTCCCTGCTATTGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025938.4-273s21c1
Sequence:CCGGCATGAAAGTCTGTCTAGAGTTCTCGAGAACTCTAGACAGACTTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025938.4-422s21c1
Sequence:CCGGTGTCGGCCATCTTGAGAATATCTCGAGATATTCTCAAGATGGCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025938.4-506s21c1
Sequence:CCGGAGTGTGCCTTCAGAGTGATTCCTCGAGGAATCACTCTGAAGGCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025938.4-477s21c1
Sequence:CCGGGACCTTGTTTGGAGCCTATAACTCGAGTTATAGGCTCCAAACAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025938
VALIDATED
RPP14 MISSION shRNA Lentiviral Transduction Particles
ribonuclease P/MRP 14kDa subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025938.4-625s21c1
Sequence:CCGGTCCTTAGGTGTCTACATTATTCTCGAGAATAATGTAGACACCTAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025938.1-1397s1c1
Sequence:CCGGCCAGAGTATCTGGGTTCAATTCTCGAGAATTGAACCCAGATACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025938.1-220s1c1
Sequence:CCGGCATGAAAGTCTGTCTAGAGTTCTCGAGAACTCTAGACAGACTTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025938.1-402s1c1
Sequence:CCGGTGGTCAAATTATGGAGTTCTTCTCGAGAAGAACTCCATAATTTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025938.1-424s1c1
Sequence:CCGGGACCTTGTTTGGAGCCTATAACTCGAGTTATAGGCTCCAAACAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025938.1-500s1c1
Sequence:CCGGTCTGGCAATAGCAGGGAACAACTCGAGTTGTTCCCTGCTATTGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025938.4-273s21c1
Sequence:CCGGCATGAAAGTCTGTCTAGAGTTCTCGAGAACTCTAGACAGACTTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025938.4-422s21c1
Sequence:CCGGTGTCGGCCATCTTGAGAATATCTCGAGATATTCTCAAGATGGCCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025938.4-506s21c1
Sequence:CCGGAGTGTGCCTTCAGAGTGATTCCTCGAGGAATCACTCTGAAGGCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025938.4-477s21c1
Sequence:CCGGGACCTTGTTTGGAGCCTATAACTCGAGTTATAGGCTCCAAACAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)