EMAIL THIS PAGE TO A FRIEND

RPP25

ribonuclease P/MRP 25kDa subunit

48 Gene Product Result for
UniProtKB ID: Q9BUL9, D3DW70, Q9NX88
Gene ID:
Mouse(102614) ribonuclease P/MRP 25 subunit
Rat(315705) ribonuclease P/MRP 25 subunit
domestic guinea pig(100713437) ribonuclease P/MRP 25kDa subunit
naked mole-rat(101714753) ribonuclease P/MRP 25kDa subunit
cow(530688) ribonuclease P/MRP 25kDa subunit
sheep(101107390) ribonuclease P/MRP 25kDa subunit
Zebrafish(100000532) ribonuclease P 25 subunit
chicken(430848) ribonuclease P/MRP 25kDa subunit
domestic cat(101084881) ribonuclease P/MRP 25kDa subunit
dog(611587) ribonuclease P/MRP 25kDa subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA046900 Anti-RPP25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017793 Rosetta Predictions human pricing
NM_001012124 Rosetta Predictions rat pricing
XM_576415 Rosetta Predictions rat pricing
NM_133982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142196 predicted 1644
2 SASI_Hs01_00142197 predicted 1574
3 SASI_Hs01_00142198 predicted 1797
4 SASI_Hs01_00142199 predicted 1467
5 SASI_Hs01_00142201 predicted 1657
6 SASI_Hs01_00142202 predicted 1805
7 SASI_Hs01_00142203 predicted 1582
8 SASI_Hs02_00350658 predicted 1647
9 SASI_Hs02_00350659 predicted 1779
10 SASI_Hs01_00142204 predicted 1466
11 SASI_Hs01_00142195 predicted 1226
12 SASI_Hs01_00142200 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036553 predicted 796
2 SASI_Rn01_00036554 predicted 936
3 SASI_Rn01_00036555 predicted 880
4 SASI_Rn01_00036556 predicted 293
5 SASI_Rn01_00036557 predicted 1137
6 SASI_Rn02_00200289 predicted 556
7 SASI_Rn01_00036558 predicted 553
8 SASI_Rn01_00036559 predicted 1003
9 SASI_Rn01_00036560 predicted 715
10 SASI_Rn01_00036561 predicted 804
11 SASI_Rn01_00036562 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160891 predicted 1062
2 SASI_Rn01_00160892 predicted 1148
3 SASI_Rn01_00160893 predicted 1108
4 SASI_Rn01_00160894 predicted 1142
5 SASI_Rn01_00160895 predicted 1145
6 SASI_Rn01_00160896 predicted 1057
7 SASI_Rn01_00160897 predicted 1150
8 SASI_Rn01_00160898 predicted 1106
9 SASI_Rn01_00160899 predicted 1113
10 SASI_Rn01_00160900 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138997 predicted 889
2 SASI_Mm01_00138998 predicted 754
3 SASI_Mm01_00138999 predicted 243
4 SASI_Mm01_00139000 predicted 810
5 SASI_Mm01_00139001 predicted 499
6 SASI_Mm01_00139002 predicted 499
7 SASI_Mm01_00139003 predicted 254
8 SASI_Mm01_00139004 predicted 234
9 SASI_Mm02_00339111 predicted 962
10 SASI_Mm01_00139006 predicted 555
11 SASI_Mm01_00139005 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133982
RPP25 MISSION shRNA Bacterial Glycerol Stock
ribonuclease P/MRP 25kDa subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133982.1-520s1c1
Sequence:CCGGCTTAAGAATGTACCGAGCCTCCTCGAGGAGGCTCGGTACATTCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133982.1-546s1c1
Sequence:CCGGCCTACTTTCAAAGGACGCACTCTCGAGAGTGCGTCCTTTGAAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133982.1-932s1c1
Sequence:CCGGCAAGGAAACTTTGTGGGACATCTCGAGATGTCCCACAAAGTTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133982.1-757s1c1
Sequence:CCGGCCAGACCGACTGAATCATATACTCGAGTATATGATTCAGTCGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133982
RPP25 MISSION shRNA shRNA Plasmid DNA
ribonuclease P/MRP 25kDa subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133982.1-520s1c1
Sequence:CCGGCTTAAGAATGTACCGAGCCTCCTCGAGGAGGCTCGGTACATTCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133982.1-546s1c1
Sequence:CCGGCCTACTTTCAAAGGACGCACTCTCGAGAGTGCGTCCTTTGAAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133982.1-932s1c1
Sequence:CCGGCAAGGAAACTTTGTGGGACATCTCGAGATGTCCCACAAAGTTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133982.1-757s1c1
Sequence:CCGGCCAGACCGACTGAATCATATACTCGAGTATATGATTCAGTCGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133982
RPP25 MISSION shRNA Lentiviral Transduction Particles
ribonuclease P/MRP 25kDa subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133982.1-520s1c1
Sequence:CCGGCTTAAGAATGTACCGAGCCTCCTCGAGGAGGCTCGGTACATTCTTAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133982.1-546s1c1
Sequence:CCGGCCTACTTTCAAAGGACGCACTCTCGAGAGTGCGTCCTTTGAAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133982.1-932s1c1
Sequence:CCGGCAAGGAAACTTTGTGGGACATCTCGAGATGTCCCACAAAGTTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133982.1-757s1c1
Sequence:CCGGCCAGACCGACTGAATCATATACTCGAGTATATGATTCAGTCGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017793
RPP25 MISSION shRNA Bacterial Glycerol Stock
ribonuclease P/MRP 25kDa subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1219s1c1
Sequence:CCGGCGCTAGTCTCAGCGTACTTAACTCGAGTTAAGTACGCTGAGACTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1428s1c1
Sequence:CCGGCGGACGAGGATCAGACGGCCTCTCGAGAGGCCGTCTGATCCTCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-964s1c1
Sequence:CCGGGCGGGTCAAGGAAGGCAGCAACTCGAGTTGCTGCCTTCCTTGACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1349s1c1
Sequence:CCGGCCAGCGTCCAAGAGGAGCCTACTCGAGTAGGCTCCTCTTGGACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-952s1c1
Sequence:CCGGCGCGGTGCACATGCGGGTCAACTCGAGTTGACCCGCATGTGCACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1821s21c1
Sequence:CCGGTGGAAGCTGAGAAGAGTTATTCTCGAGAATAACTCTTCTCAGCTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1576s21c1
Sequence:CCGGACAGGTAGCATGGACCTTAAGCTCGAGCTTAAGGTCCATGCTACCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1649s21c1
Sequence:CCGGGGGAAACTTCGTGCGATAATTCTCGAGAATTATCGCACGAAGTTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017793
RPP25 MISSION shRNA shRNA Plasmid DNA
ribonuclease P/MRP 25kDa subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1219s1c1
Sequence:CCGGCGCTAGTCTCAGCGTACTTAACTCGAGTTAAGTACGCTGAGACTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1428s1c1
Sequence:CCGGCGGACGAGGATCAGACGGCCTCTCGAGAGGCCGTCTGATCCTCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-964s1c1
Sequence:CCGGGCGGGTCAAGGAAGGCAGCAACTCGAGTTGCTGCCTTCCTTGACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1349s1c1
Sequence:CCGGCCAGCGTCCAAGAGGAGCCTACTCGAGTAGGCTCCTCTTGGACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-952s1c1
Sequence:CCGGCGCGGTGCACATGCGGGTCAACTCGAGTTGACCCGCATGTGCACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1821s21c1
Sequence:CCGGTGGAAGCTGAGAAGAGTTATTCTCGAGAATAACTCTTCTCAGCTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1576s21c1
Sequence:CCGGACAGGTAGCATGGACCTTAAGCTCGAGCTTAAGGTCCATGCTACCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1649s21c1
Sequence:CCGGGGGAAACTTCGTGCGATAATTCTCGAGAATTATCGCACGAAGTTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017793
RPP25 MISSION shRNA Lentiviral Transduction Particles
ribonuclease P/MRP 25kDa subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1219s1c1
Sequence:CCGGCGCTAGTCTCAGCGTACTTAACTCGAGTTAAGTACGCTGAGACTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1428s1c1
Sequence:CCGGCGGACGAGGATCAGACGGCCTCTCGAGAGGCCGTCTGATCCTCGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-964s1c1
Sequence:CCGGGCGGGTCAAGGAAGGCAGCAACTCGAGTTGCTGCCTTCCTTGACCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-1349s1c1
Sequence:CCGGCCAGCGTCCAAGAGGAGCCTACTCGAGTAGGCTCCTCTTGGACGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017793.1-952s1c1
Sequence:CCGGCGCGGTGCACATGCGGGTCAACTCGAGTTGACCCGCATGTGCACCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1821s21c1
Sequence:CCGGTGGAAGCTGAGAAGAGTTATTCTCGAGAATAACTCTTCTCAGCTTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1576s21c1
Sequence:CCGGACAGGTAGCATGGACCTTAAGCTCGAGCTTAAGGTCCATGCTACCTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017793.2-1649s21c1
Sequence:CCGGGGGAAACTTCGTGCGATAATTCTCGAGAATTATCGCACGAAGTTTCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)