EMAIL THIS PAGE TO A FRIEND

RPP25L

ribonuclease P/MRP 25kDa subunit-like

78 Gene Product Result for
Synonyms: C9orf23 bA296L22.5
UniProtKB ID: Q8N5L8, D3DRM5
Gene ID:
Human(138716) Summary: This gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. Members of this family are small archaebacterial proteins with no known function. Alternative splicing has been observed at this locus and two variants, both encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(69961) ribonuclease P/MRP 25 subunit-like
Rat(298002) ribonuclease P/MRP 25 subunit-like
Zebrafish(436813) ribonuclease P/MRP 25 subunit-like
domestic cat(101084398) ribonuclease P/MRP 25kDa subunit-like
cow(512203) chromosome 8 open reading frame, human C9orf23
sheep(101121490) ribonuclease P/MRP 25kDa subunit-like
naked mole-rat(101705221) ribonuclease P/MRP 25kDa subunit-like
domestic guinea pig(100725847) ribonuclease P/MRP 25kDa subunit-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_148178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148178 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148178 Rosetta Predictions human pricing
NM_148179 Rosetta Predictions human pricing
NM_001106648 Rosetta Predictions rat pricing
NM_027278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033219 predicted 627
2 SASI_Hs01_00033220 predicted 458
3 SASI_Hs01_00033222 predicted 330
4 SASI_Hs01_00033223 predicted 272
5 SASI_Hs01_00033224 predicted 586
6 SASI_Hs01_00033225 predicted 579
7 SASI_Hs01_00033226 predicted 389
8 SASI_Hs01_00033227 predicted 562
9 SASI_Hs01_00033228 predicted 545
10 SASI_Hs02_00365573 predicted 624
11 SASI_Hs01_00033221 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051458 predicted 831
2 SASI_Hs01_00051459 predicted 656
3 SASI_Hs01_00051461 predicted 536
4 SASI_Hs01_00051462 predicted 473
5 SASI_Hs01_00051463 predicted 781
6 SASI_Hs01_00051464 predicted 783
7 SASI_Hs01_00051465 predicted 593
8 SASI_Hs01_00051466 predicted 761
9 SASI_Hs01_00051467 predicted 746
10 SASI_Hs02_00365574 predicted 826
11 SASI_Hs01_00051460 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221018 predicted 501
2 SASI_Rn02_00221019 predicted 412
3 SASI_Rn02_00221020 predicted 201
4 SASI_Rn02_00221021 predicted 464
5 SASI_Rn02_00221022 predicted 500
6 SASI_Rn02_00221023 predicted 361
7 SASI_Rn02_00221024 predicted 283
8 SASI_Rn02_00221025 predicted 239
9 SASI_Rn02_00221026 predicted 281
10 SASI_Rn02_00221027 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331865 predicted 498
2 SASI_Mm01_00153609 predicted 586
3 SASI_Mm01_00153610 predicted 240
4 SASI_Mm01_00153611 predicted 468
5 SASI_Mm01_00153612 predicted 491
6 SASI_Mm01_00153613 predicted 583
7 SASI_Mm01_00153614 predicted 585
8 SASI_Mm01_00153615 predicted 361
9 SASI_Mm01_00153616 predicted 419
10 SASI_Mm01_00153617 predicted 578
11 SASI_Mm01_00153608 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027278
VALIDATED
RPP25L MISSION shRNA Bacterial Glycerol Stock
ribonuclease P/MRP 25kDa subunit-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027278.2-121s21c1
Sequence:CCGGCTTCCAGCCTCATCACCAATGCTCGAGCATTGGTGATGAGGCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027278.2-291s21c1
Sequence:CCGGCAGCTGTGCAGAGATTGTCAACTCGAGTTGACAATCTCTGCACAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027278.2-150s21c1
Sequence:CCGGACCTCCTGACACTCTGGAAATCTCGAGATTTCCAGAGTGTCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027278.2-596s21c1
Sequence:CCGGACTGTTCTCTAGACCTGAATACTCGAGTATTCAGGTCTAGAGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027278
VALIDATED
RPP25L MISSION shRNA shRNA Plasmid DNA
ribonuclease P/MRP 25kDa subunit-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027278.2-121s21c1
Sequence:CCGGCTTCCAGCCTCATCACCAATGCTCGAGCATTGGTGATGAGGCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027278.2-291s21c1
Sequence:CCGGCAGCTGTGCAGAGATTGTCAACTCGAGTTGACAATCTCTGCACAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027278.2-150s21c1
Sequence:CCGGACCTCCTGACACTCTGGAAATCTCGAGATTTCCAGAGTGTCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027278.2-596s21c1
Sequence:CCGGACTGTTCTCTAGACCTGAATACTCGAGTATTCAGGTCTAGAGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027278
VALIDATED
RPP25L MISSION shRNA Lentiviral Transduction Particles
ribonuclease P/MRP 25kDa subunit-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027278.2-121s21c1
Sequence:CCGGCTTCCAGCCTCATCACCAATGCTCGAGCATTGGTGATGAGGCTGGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000282981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027278.2-291s21c1
Sequence:CCGGCAGCTGTGCAGAGATTGTCAACTCGAGTTGACAATCTCTGCACAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027278.2-150s21c1
Sequence:CCGGACCTCCTGACACTCTGGAAATCTCGAGATTTCCAGAGTGTCAGGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027278.2-596s21c1
Sequence:CCGGACTGTTCTCTAGACCTGAATACTCGAGTATTCAGGTCTAGAGAACAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148178
VALIDATED
RPP25L MISSION shRNA Bacterial Glycerol Stock
ribonuclease P/MRP 25kDa subunit-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148178.1-636s21c1
Sequence:CCGGCGTTGTGACTGCTCAACATCCCTCGAGGGATGTTGAGCAGTCACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-331s1c1
Sequence:CCGGCCAAGCTACGTTTCCTTCAGACTCGAGTCTGAAGGAAACGTAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-460s1c1
Sequence:CCGGCCAATGAGTGTGGTTACCAACCTCGAGGTTGGTAACCACACTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-229s21c1
Sequence:CCGGGTGCTCGGCATGTAGTGTTCTCTCGAGAGAACACTACATGCCGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-137s21c1
Sequence:CCGGGCTACCTCCTGATACCCTTGACTCGAGTCAAGGGTATCAGGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-460s21c1
Sequence:CCGGCCAATGAGTGTGGTTACCAACCTCGAGGTTGGTAACCACACTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148178.1-324s21c1
Sequence:CCGGCAGCTCACCAAGCTACGTTTCCTCGAGGAAACGTAGCTTGGTGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-335s1c1
Sequence:CCGGGCTACGTTTCCTTCAGACTGACTCGAGTCAGTCTGAAGGAAACGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148178
VALIDATED
RPP25L MISSION shRNA shRNA Plasmid DNA
ribonuclease P/MRP 25kDa subunit-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148178.1-636s21c1
Sequence:CCGGCGTTGTGACTGCTCAACATCCCTCGAGGGATGTTGAGCAGTCACAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-331s1c1
Sequence:CCGGCCAAGCTACGTTTCCTTCAGACTCGAGTCTGAAGGAAACGTAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-460s1c1
Sequence:CCGGCCAATGAGTGTGGTTACCAACCTCGAGGTTGGTAACCACACTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-229s21c1
Sequence:CCGGGTGCTCGGCATGTAGTGTTCTCTCGAGAGAACACTACATGCCGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-137s21c1
Sequence:CCGGGCTACCTCCTGATACCCTTGACTCGAGTCAAGGGTATCAGGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-460s21c1
Sequence:CCGGCCAATGAGTGTGGTTACCAACCTCGAGGTTGGTAACCACACTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148178.1-324s21c1
Sequence:CCGGCAGCTCACCAAGCTACGTTTCCTCGAGGAAACGTAGCTTGGTGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-335s1c1
Sequence:CCGGGCTACGTTTCCTTCAGACTGACTCGAGTCAGTCTGAAGGAAACGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148178
VALIDATED
RPP25L MISSION shRNA Lentiviral Transduction Particles
ribonuclease P/MRP 25kDa subunit-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148178.1-636s21c1
Sequence:CCGGCGTTGTGACTGCTCAACATCCCTCGAGGGATGTTGAGCAGTCACAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000172767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-331s1c1
Sequence:CCGGCCAAGCTACGTTTCCTTCAGACTCGAGTCTGAAGGAAACGTAGCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000172370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-460s1c1
Sequence:CCGGCCAATGAGTGTGGTTACCAACCTCGAGGTTGGTAACCACACTCATTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-229s21c1
Sequence:CCGGGTGCTCGGCATGTAGTGTTCTCTCGAGAGAACACTACATGCCGAGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-137s21c1
Sequence:CCGGGCTACCTCCTGATACCCTTGACTCGAGTCAAGGGTATCAGGAGGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_148178.1-460s21c1
Sequence:CCGGCCAATGAGTGTGGTTACCAACCTCGAGGTTGGTAACCACACTCATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148178.1-324s21c1
Sequence:CCGGCAGCTCACCAAGCTACGTTTCCTCGAGGAAACGTAGCTTGGTGAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000172935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148178.1-335s1c1
Sequence:CCGGGCTACGTTTCCTTCAGACTGACTCGAGTCAGTCTGAAGGAAACGTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???