EMAIL THIS PAGE TO A FRIEND

RPRD1A

regulation of nuclear pre-mRNA domain containing 1A

231 Gene Product Result for
Synonyms: HsT3101 P15RS
UniProtKB ID: Q96P16, A8KA42, B2RBA3, Q7Z5G8, Q96FY9, Q9NVL4
Gene ID:
Human(55197) Summary: P15RS is upregulated in cells overexpressing cyclin-dependent kinase inhibitor p15(INK4b) (CDKN2B; MIM 600431) and may have a role in cell cycle regulation (Liu et al., 2002 [PubMed 12470661]
Mouse(225283) regulation of nuclear pre-mRNA domain containing 1A
Rat(291736) regulation of nuclear pre-mRNA domain containing 1A
chicken(420953) regulation of nuclear pre-mRNA domain containing 1A
domestic cat(101094960) regulation of nuclear pre-mRNA domain containing 1A
dog(490483) regulation of nuclear pre-mRNA domain containing 1A
cow(504355) regulation of nuclear pre-mRNA domain containing 1A
sheep(101109318) regulation of nuclear pre-mRNA domain containing 1A
naked mole-rat(101712526) regulation of nuclear pre-mRNA domain containing 1A
domestic guinea pig(100733899) regulation of nuclear pre-mRNA domain containing 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018170 Rosetta Predictions human pricing
XM_001056597 Rosetta Predictions rat pricing
XM_214609 Rosetta Predictions rat pricing
NM_144861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124517 predicted 570
2 SASI_Hs01_00124518 predicted 331
3 SASI_Hs01_00124519 predicted 488
4 SASI_Hs01_00124520 predicted 700
5 SASI_Hs02_00351424 predicted 560
6 SASI_Hs01_00124521 predicted 507
7 SASI_Hs01_00124522 predicted 285
8 SASI_Hs01_00124523 predicted 952
9 SASI_Hs01_00124524 predicted 918
10 SASI_Hs01_00124525 predicted 415
11 SASI_Hs01_00124526 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283729 predicted 509
2 SASI_Rn02_00283730 predicted 643
3 SASI_Rn02_00283731 predicted 396
4 SASI_Rn02_00283732 predicted 510
5 SASI_Rn02_00283733 predicted 814
6 SASI_Rn02_00283734 predicted 739
7 SASI_Rn02_00283735 predicted 425
8 SASI_Rn02_00283736 predicted 1012
9 SASI_Rn02_00283737 predicted 769
10 SASI_Rn02_00283738 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375425 predicted 732
2 SASI_Rn02_00375426 predicted 871
3 SASI_Rn02_00375427 predicted 623
4 SASI_Rn02_00375428 predicted 730
5 SASI_Rn02_00375429 predicted 1038
6 SASI_Rn02_00375430 predicted 958
7 SASI_Rn02_00375431 predicted 643
8 SASI_Rn02_00375432 predicted 1236
9 SASI_Rn02_00375433 predicted 998
10 SASI_Rn02_00375434 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150040 predicted 470
2 SASI_Mm01_00150041 predicted 628
3 SASI_Mm01_00150042 predicted 381
4 SASI_Mm01_00150043 predicted 420
5 SASI_Mm01_00150044 predicted 560
6 SASI_Mm01_00150046 predicted 405
7 SASI_Mm02_00340288 predicted 827
8 SASI_Mm01_00150047 predicted 469
9 SASI_Mm01_00150048 predicted 527
10 SASI_Mm01_00150049 predicted 453
11 SASI_Mm01_00150045 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018170
VALIDATED
RPRD1A MISSION shRNA Bacterial Glycerol Stock
regulation of nuclear pre-mRNA domain containing 1A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-649s21c1
Sequence:CCGGATGGTAGAGGATGCGTGTATGCTCGAGCATACACGCATCCTCTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-770s21c1
Sequence:CCGGTTGCAGAGAAAGAGCATAAATCTCGAGATTTATGCTCTTTCTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-316s21c1
Sequence:CCGGCTTGGAAGAGTGTTATCTATTCTCGAGAATAGATAACACTCTTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-698s1c1
Sequence:CCGGGCGGCAGAAATAGATGATAGACTCGAGTCTATCATCTATTTCTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-1825s1c1
Sequence:CCGGCCCTTGCTCATATAACTTTAACTCGAGTTAAAGTTATATGAGCAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018170.x-725s1c1
Sequence:CCGGCTCACTCGAATGTTAGCAGATCTCGAGATCTGCTAACATTCGAGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018170.x-699s1c1
Sequence:CCGGCGGCAGAAATAGATGATAGAACTCGAGTTCTATCATCTATTTCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-565s1c1
Sequence:CCGGGATAGCTTCTTTACCTGTTGACTCGAGTCAACAGGTAAAGAAGCTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018170
VALIDATED
RPRD1A MISSION shRNA shRNA Plasmid DNA
regulation of nuclear pre-mRNA domain containing 1A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-649s21c1
Sequence:CCGGATGGTAGAGGATGCGTGTATGCTCGAGCATACACGCATCCTCTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-770s21c1
Sequence:CCGGTTGCAGAGAAAGAGCATAAATCTCGAGATTTATGCTCTTTCTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-316s21c1
Sequence:CCGGCTTGGAAGAGTGTTATCTATTCTCGAGAATAGATAACACTCTTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-698s1c1
Sequence:CCGGGCGGCAGAAATAGATGATAGACTCGAGTCTATCATCTATTTCTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-1825s1c1
Sequence:CCGGCCCTTGCTCATATAACTTTAACTCGAGTTAAAGTTATATGAGCAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018170.x-725s1c1
Sequence:CCGGCTCACTCGAATGTTAGCAGATCTCGAGATCTGCTAACATTCGAGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018170.x-699s1c1
Sequence:CCGGCGGCAGAAATAGATGATAGAACTCGAGTTCTATCATCTATTTCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-565s1c1
Sequence:CCGGGATAGCTTCTTTACCTGTTGACTCGAGTCAACAGGTAAAGAAGCTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018170
VALIDATED
RPRD1A MISSION shRNA Lentiviral Transduction Particles
regulation of nuclear pre-mRNA domain containing 1A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-649s21c1
Sequence:CCGGATGGTAGAGGATGCGTGTATGCTCGAGCATACACGCATCCTCTACCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-770s21c1
Sequence:CCGGTTGCAGAGAAAGAGCATAAATCTCGAGATTTATGCTCTTTCTCTGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018170.3-316s21c1
Sequence:CCGGCTTGGAAGAGTGTTATCTATTCTCGAGAATAGATAACACTCTTCCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-698s1c1
Sequence:CCGGGCGGCAGAAATAGATGATAGACTCGAGTCTATCATCTATTTCTGCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-1825s1c1
Sequence:CCGGCCCTTGCTCATATAACTTTAACTCGAGTTAAAGTTATATGAGCAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018170.x-725s1c1
Sequence:CCGGCTCACTCGAATGTTAGCAGATCTCGAGATCTGCTAACATTCGAGTGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018170.x-699s1c1
Sequence:CCGGCGGCAGAAATAGATGATAGAACTCGAGTTCTATCATCTATTTCTGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018170.x-565s1c1
Sequence:CCGGGATAGCTTCTTTACCTGTTGACTCGAGTCAACAGGTAAAGAAGCTATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144861
VALIDATED
RPRD1A MISSION shRNA Bacterial Glycerol Stock
regulation of nuclear pre-mRNA domain containing 1A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-1065s1c1
Sequence:CCGGCATGGAGACAGGTTAGGTGAACTCGAGTTCACCTAACCTGTCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-781s1c1
Sequence:CCGGGCGGCAGAAATAGATGATAGACTCGAGTCTATCATCTATTTCTGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144861.1-498s1c1
Sequence:CCGGGAAGAGGACTTATGAGCAAATCTCGAGATTTGCTCATAAGTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144861.2-448s1c1
Sequence:CCGGCTTGGAAGAGTGTTATCTATTCTCGAGAATAGATAACACTCTTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-877s1c1
Sequence:CCGGGAAGAATACAAGCGCAAGTTACTCGAGTAACTTGCGCTTGTATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-1119s1c1
Sequence:CCGGGAATGGTACTAACACAAGAAACTCGAGTTTCTTGTGTTAGTACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144861
VALIDATED
RPRD1A MISSION shRNA shRNA Plasmid DNA
regulation of nuclear pre-mRNA domain containing 1A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-1065s1c1
Sequence:CCGGCATGGAGACAGGTTAGGTGAACTCGAGTTCACCTAACCTGTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-781s1c1
Sequence:CCGGGCGGCAGAAATAGATGATAGACTCGAGTCTATCATCTATTTCTGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144861.1-498s1c1
Sequence:CCGGGAAGAGGACTTATGAGCAAATCTCGAGATTTGCTCATAAGTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144861.2-448s1c1
Sequence:CCGGCTTGGAAGAGTGTTATCTATTCTCGAGAATAGATAACACTCTTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-877s1c1
Sequence:CCGGGAAGAATACAAGCGCAAGTTACTCGAGTAACTTGCGCTTGTATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-1119s1c1
Sequence:CCGGGAATGGTACTAACACAAGAAACTCGAGTTTCTTGTGTTAGTACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144861
VALIDATED
RPRD1A MISSION shRNA Lentiviral Transduction Particles
regulation of nuclear pre-mRNA domain containing 1A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-1065s1c1
Sequence:CCGGCATGGAGACAGGTTAGGTGAACTCGAGTTCACCTAACCTGTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-781s1c1
Sequence:CCGGGCGGCAGAAATAGATGATAGACTCGAGTCTATCATCTATTTCTGCCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144861.1-498s1c1
Sequence:CCGGGAAGAGGACTTATGAGCAAATCTCGAGATTTGCTCATAAGTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144861.2-448s1c1
Sequence:CCGGCTTGGAAGAGTGTTATCTATTCTCGAGAATAGATAACACTCTTCCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-877s1c1
Sequence:CCGGGAAGAATACAAGCGCAAGTTACTCGAGTAACTTGCGCTTGTATTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144861.1-1119s1c1
Sequence:CCGGGAATGGTACTAACACAAGAAACTCGAGTTTCTTGTGTTAGTACCATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)