EMAIL THIS PAGE TO A FRIEND

RPS15A

ribosomal protein S15a

30 Gene Product Result for
Synonyms: S15a
UniProtKB ID: P62244, P39027, P39031, Q3MHD9, Q8C023, Q9BV24
Gene ID:
Human(6210) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S8P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(267019) ribosomal protein S15A
Rat(117053) ribosomal protein S15a
cow(337888) ribosomal protein S15A
sheep(101115173) ribosomal protein S15a
Goat(100861065) ribosomal protein S15a
cow(619131) ribosomal protein S15a
domestic guinea pig(100713320) ribosomal protein S15a
naked mole-rat(101697160) ribosomal protein S15a
Thale Cress(837291) 40S ribosomal protein S15a-1
Zebrafish(336764) ribosomal protein S15a
domestic cat(101095707) ribosomal protein S15a
dog(100683775) ribosomal protein S15a
chicken(427675) ribosomal protein S15a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001019 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001019 Rosetta Predictions human pricing
NM_001030009 Rosetta Predictions human pricing
NM_053982 Rosetta Predictions rat pricing
NM_170669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225534 predicted 169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073762 predicted 111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074536 predicted 213
2 SASI_Rn01_00074537 predicted 198
3 SASI_Rn01_00074538 predicted 208
4 SASI_Rn01_00074539 predicted 208
5 SASI_Rn01_00074540 predicted 210
6 SASI_Rn01_00074541 predicted 198
7 SASI_Rn01_00074542 predicted 214
8 SASI_Rn01_00074543 predicted 295
9 SASI_Rn01_00074544 predicted 178
10 SASI_Rn01_00074545 predicted 11
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098364 predicted 486
2 SASI_Mm01_00098365 predicted 576
3 SASI_Mm01_00098366 predicted 576
4 SASI_Mm01_00098367 predicted 572
5 SASI_Mm01_00098368 predicted 605
6 SASI_Mm01_00098369 predicted 591
7 SASI_Mm01_00098370 predicted 439
8 SASI_Mm01_00098371 predicted 552
9 SASI_Mm01_00098372 predicted 473
10 SASI_Mm01_00098373 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170669
VALIDATED
RPS15A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S15a
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-573s21c1
Sequence:CCGGACCTCCAGCTTGGGTTGTATGCTCGAGCATACAACCCAAGCTGGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-747s21c1
Sequence:CCGGTCACACTGTTGGCTCTTAATCCTCGAGGATTAAGAGCCAACAGTGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-724s21c1
Sequence:CCGGAGACTTGGTAGACTTACATTCCTCGAGGAATGTAAGTCTACCAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-796s21c1
Sequence:CCGGTATCAAGGCTAGTCTAGATTCCTCGAGGAATCTAGACTAGCCTTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170669.2-3475s1c1
Sequence:CCGGCCGACCTTAATTGTTTACTTACTCGAGTAAGTAAACAATTAAGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_170669.2-339s1c1
Sequence:CCGGGCTGGCATTATGGACCATGAACTCGAGTTCATGGTCCATAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_170669.2-134s1c1
Sequence:CCGGCGTGATGATGAAGCACGGATACTCGAGTATCCGTGCTTCATCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170669.2-272s1c1
Sequence:CCGGCCTAGAGAAATGGCAGAACAACTCGAGTTGTTCTGCCATTTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170669.2-146s1c1
Sequence:CCGGGCACGGATACATTGGTGAATTCTCGAGAATTCACCAATGTATCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170669
VALIDATED
RPS15A MISSION shRNA shRNA Plasmid DNA
ribosomal protein S15a
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-573s21c1
Sequence:CCGGACCTCCAGCTTGGGTTGTATGCTCGAGCATACAACCCAAGCTGGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-747s21c1
Sequence:CCGGTCACACTGTTGGCTCTTAATCCTCGAGGATTAAGAGCCAACAGTGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-724s21c1
Sequence:CCGGAGACTTGGTAGACTTACATTCCTCGAGGAATGTAAGTCTACCAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-796s21c1
Sequence:CCGGTATCAAGGCTAGTCTAGATTCCTCGAGGAATCTAGACTAGCCTTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170669.2-3475s1c1
Sequence:CCGGCCGACCTTAATTGTTTACTTACTCGAGTAAGTAAACAATTAAGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_170669.2-339s1c1
Sequence:CCGGGCTGGCATTATGGACCATGAACTCGAGTTCATGGTCCATAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_170669.2-134s1c1
Sequence:CCGGCGTGATGATGAAGCACGGATACTCGAGTATCCGTGCTTCATCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170669.2-272s1c1
Sequence:CCGGCCTAGAGAAATGGCAGAACAACTCGAGTTGTTCTGCCATTTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170669.2-146s1c1
Sequence:CCGGGCACGGATACATTGGTGAATTCTCGAGAATTCACCAATGTATCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170669
VALIDATED
RPS15A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S15a
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-573s21c1
Sequence:CCGGACCTCCAGCTTGGGTTGTATGCTCGAGCATACAACCCAAGCTGGAGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-747s21c1
Sequence:CCGGTCACACTGTTGGCTCTTAATCCTCGAGGATTAAGAGCCAACAGTGTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-724s21c1
Sequence:CCGGAGACTTGGTAGACTTACATTCCTCGAGGAATGTAAGTCTACCAAGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170669.2-796s21c1
Sequence:CCGGTATCAAGGCTAGTCTAGATTCCTCGAGGAATCTAGACTAGCCTTGATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170669.2-3475s1c1
Sequence:CCGGCCGACCTTAATTGTTTACTTACTCGAGTAAGTAAACAATTAAGGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_170669.2-339s1c1
Sequence:CCGGGCTGGCATTATGGACCATGAACTCGAGTTCATGGTCCATAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_170669.2-134s1c1
Sequence:CCGGCGTGATGATGAAGCACGGATACTCGAGTATCCGTGCTTCATCATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170669.2-272s1c1
Sequence:CCGGCCTAGAGAAATGGCAGAACAACTCGAGTTGTTCTGCCATTTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170669.2-146s1c1
Sequence:CCGGGCACGGATACATTGGTGAATTCTCGAGAATTCACCAATGTATCCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001019
VALIDATED
RPS15A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S15a
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-124s21c1
Sequence:CCGGGCTCTCAAGAGTATCAACAATCTCGAGATTGTTGATACTCTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-201s21c1
Sequence:CCGGCCGGTTTCTCACTGTGATGATCTCGAGATCATCACAGTGAGAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-225s21c1
Sequence:CCGGGCATGGTTACATTGGCGAATTCTCGAGAATTCGCCAATGTAACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001019.4-361s21c1
Sequence:CCGGTGGCAGAATAATCTGCTTCCACTCGAGTGGAAGCAGATTATTCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-337s21c1
Sequence:CCGGGTGCAACTCAAAGACCTGGAACTCGAGTTCCAGGTCTTTGAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-337s1c1
Sequence:CCGGGTGCAACTCAAAGACCTGGAACTCGAGTTCCAGGTCTTTGAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-201s1c1
Sequence:CCGGCCGGTTTCTCACTGTGATGATCTCGAGATCATCACAGTGAGAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-361s1c1
Sequence:CCGGTGGCAGAATAATCTGCTTCCACTCGAGTGGAAGCAGATTATTCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-124s1c1
Sequence:CCGGGCTCTCAAGAGTATCAACAATCTCGAGATTGTTGATACTCTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-225s1c1
Sequence:CCGGGCATGGTTACATTGGCGAATTCTCGAGAATTCGCCAATGTAACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001019
VALIDATED
RPS15A MISSION shRNA shRNA Plasmid DNA
ribosomal protein S15a
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-124s21c1
Sequence:CCGGGCTCTCAAGAGTATCAACAATCTCGAGATTGTTGATACTCTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-201s21c1
Sequence:CCGGCCGGTTTCTCACTGTGATGATCTCGAGATCATCACAGTGAGAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-225s21c1
Sequence:CCGGGCATGGTTACATTGGCGAATTCTCGAGAATTCGCCAATGTAACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001019.4-361s21c1
Sequence:CCGGTGGCAGAATAATCTGCTTCCACTCGAGTGGAAGCAGATTATTCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-337s21c1
Sequence:CCGGGTGCAACTCAAAGACCTGGAACTCGAGTTCCAGGTCTTTGAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-337s1c1
Sequence:CCGGGTGCAACTCAAAGACCTGGAACTCGAGTTCCAGGTCTTTGAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-201s1c1
Sequence:CCGGCCGGTTTCTCACTGTGATGATCTCGAGATCATCACAGTGAGAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-361s1c1
Sequence:CCGGTGGCAGAATAATCTGCTTCCACTCGAGTGGAAGCAGATTATTCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-124s1c1
Sequence:CCGGGCTCTCAAGAGTATCAACAATCTCGAGATTGTTGATACTCTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-225s1c1
Sequence:CCGGGCATGGTTACATTGGCGAATTCTCGAGAATTCGCCAATGTAACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001019
VALIDATED
RPS15A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S15a
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-124s21c1
Sequence:CCGGGCTCTCAAGAGTATCAACAATCTCGAGATTGTTGATACTCTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-201s21c1
Sequence:CCGGCCGGTTTCTCACTGTGATGATCTCGAGATCATCACAGTGAGAAACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-225s21c1
Sequence:CCGGGCATGGTTACATTGGCGAATTCTCGAGAATTCGCCAATGTAACCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001019.4-361s21c1
Sequence:CCGGTGGCAGAATAATCTGCTTCCACTCGAGTGGAAGCAGATTATTCTGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001019.4-337s21c1
Sequence:CCGGGTGCAACTCAAAGACCTGGAACTCGAGTTCCAGGTCTTTGAGTTGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-337s1c1
Sequence:CCGGGTGCAACTCAAAGACCTGGAACTCGAGTTCCAGGTCTTTGAGTTGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-201s1c1
Sequence:CCGGCCGGTTTCTCACTGTGATGATCTCGAGATCATCACAGTGAGAAACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-361s1c1
Sequence:CCGGTGGCAGAATAATCTGCTTCCACTCGAGTGGAAGCAGATTATTCTGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-124s1c1
Sequence:CCGGGCTCTCAAGAGTATCAACAATCTCGAGATTGTTGATACTCTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001019.3-225s1c1
Sequence:CCGGGCATGGTTACATTGGCGAATTCTCGAGAATTCGCCAATGTAACCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)