EMAIL THIS PAGE TO A FRIEND

RPS3A

ribosomal protein S3A

24 Gene Product Result for
Synonyms: FTE1 MFTL S3A
UniProtKB ID: P61247, B2R4D4, D3DP05, P33443, P49241
Gene ID:
Human(6189) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Rat(29288) ribosomal protein S3a
fruit fly(43768) Ribosomal protein S3A
domestic cat(768276) ribosomal protein S3A
dog(403677) ribosomal protein S3A
chicken(422477) ribosomal protein S3A
Zebrafish(337240) ribosomal protein S3A
domestic guinea pig(100725413) ribosomal protein S3A
cow(282053) ribosomal protein S3A
sheep(101106110) ribosomal protein S3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107471 MISSION® esiRNA esiRNA human RPS3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006 Rosetta Predictions human pricing
NM_017153 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305063 predicted 228
2 SASI_Hs02_00305064 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047698 predicted 440
2 SASI_Rn01_00047699 predicted 451
3 SASI_Rn01_00047700 predicted 628
4 SASI_Rn01_00047701 predicted 502
5 SASI_Rn01_00047702 predicted 196
6 SASI_Rn01_00047704 predicted 278
7 SASI_Rn01_00047706 predicted 256
8 SASI_Rn02_00261445 predicted 375
9 SASI_Rn02_00261446 predicted 591
10 SASI_Rn01_00047707 predicted 250
11 SASI_Rn01_00047703 predicted 235
12 SASI_Rn01_00047705 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006
VALIDATED
RPS3A MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S3A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-543s21c1
Sequence:CCGGCCGGAAGAAGATGATGGAAATCTCGAGATTTCCATCATCTTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-154s21c1
Sequence:CCGGGCACCTGCTATGTTCAATATACTCGAGTATATTGAACATAGCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-711s21c1
Sequence:CCGGGCCCAAGTTTGAATTGGGAAACTCGAGTTTCCCAATTCAAACTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006.2-91s1c1
Sequence:CCGGGCCAAGAAGAAAGTGGTTGATCTCGAGATCAACCACTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006.2-534s1c1
Sequence:CCGGCCGGAAGAAGATGATGGAAATCTCGAGATTTCCATCATCTTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006.2-145s1c1
Sequence:CCGGGCACCTGCTATGTTCAATATACTCGAGTATATTGAACATAGCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006.2-702s1c1
Sequence:CCGGGCCCAAGTTTGAATTGGGAAACTCGAGTTTCCCAATTCAAACTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-100s21c1
Sequence:CCGGGCCAAGAAGAAAGTGGTTGATCTCGAGATCAACCACTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006
VALIDATED
RPS3A MISSION shRNA shRNA Plasmid DNA
ribosomal protein S3A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-543s21c1
Sequence:CCGGCCGGAAGAAGATGATGGAAATCTCGAGATTTCCATCATCTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-154s21c1
Sequence:CCGGGCACCTGCTATGTTCAATATACTCGAGTATATTGAACATAGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-711s21c1
Sequence:CCGGGCCCAAGTTTGAATTGGGAAACTCGAGTTTCCCAATTCAAACTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006.2-91s1c1
Sequence:CCGGGCCAAGAAGAAAGTGGTTGATCTCGAGATCAACCACTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006.2-534s1c1
Sequence:CCGGCCGGAAGAAGATGATGGAAATCTCGAGATTTCCATCATCTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006.2-145s1c1
Sequence:CCGGGCACCTGCTATGTTCAATATACTCGAGTATATTGAACATAGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006.2-702s1c1
Sequence:CCGGGCCCAAGTTTGAATTGGGAAACTCGAGTTTCCCAATTCAAACTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-100s21c1
Sequence:CCGGGCCAAGAAGAAAGTGGTTGATCTCGAGATCAACCACTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006
VALIDATED
RPS3A MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S3A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-543s21c1
Sequence:CCGGCCGGAAGAAGATGATGGAAATCTCGAGATTTCCATCATCTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-154s21c1
Sequence:CCGGGCACCTGCTATGTTCAATATACTCGAGTATATTGAACATAGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-711s21c1
Sequence:CCGGGCCCAAGTTTGAATTGGGAAACTCGAGTTTCCCAATTCAAACTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006.2-91s1c1
Sequence:CCGGGCCAAGAAGAAAGTGGTTGATCTCGAGATCAACCACTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006.2-534s1c1
Sequence:CCGGCCGGAAGAAGATGATGGAAATCTCGAGATTTCCATCATCTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006.2-145s1c1
Sequence:CCGGGCACCTGCTATGTTCAATATACTCGAGTATATTGAACATAGCAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006.2-702s1c1
Sequence:CCGGGCCCAAGTTTGAATTGGGAAACTCGAGTTTCCCAATTCAAACTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006.3-100s21c1
Sequence:CCGGGCCAAGAAGAAAGTGGTTGATCTCGAGATCAACCACTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)