EMAIL THIS PAGE TO A FRIEND

RPS5

ribosomal protein S5

47 Gene Product Result for
Synonyms: S5
UniProtKB ID: P46782, B2R4T2, Q96BN0
Gene ID:
Human(6193) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S7P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(20103) ribosomal protein S5
Rat(25538) ribosomal protein S5
domestic guinea pig(100718384) ribosomal protein S5
naked mole-rat(101703468) ribosomal protein S5
cow(506229) ribosomal protein S5
sheep(101111994) ribosomal protein S5
Thale Cress(837775) disease resistance protein RPS5
domestic cat(101086933) ribosomal protein S5
Zebrafish(192297) ribosomal protein S5
dog(476366) ribosomal protein S5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009 Rosetta Predictions human pricing
NM_001105722 Rosetta Predictions rat pricing
NM_009095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142487 predicted 233
2 SASI_Hs01_00142489 predicted 442
3 SASI_Hs01_00142481 predicted 285
4 SASI_Hs01_00142490 predicted 227
5 SASI_Hs01_00142482 predicted 321
6 SASI_Hs02_00305603 predicted 352
7 SASI_Hs02_00305604 predicted 335
8 SASI_Hs02_00305605 predicted 255
9 SASI_Hs01_00142485 predicted 267
10 SASI_Hs02_00305606 predicted 344
11 SASI_Hs01_00142483 predicted 310
12 SASI_Hs01_00142484 predicted 257
13 SASI_Hs01_00142486 predicted 254
14 SASI_Hs01_00142488 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211886 predicted 267
2 SASI_Rn02_00211887 predicted 341
3 SASI_Rn02_00211888 predicted 247
4 SASI_Rn02_00211889 predicted 308
5 SASI_Rn02_00211890 predicted 348
6 SASI_Rn02_00211891 predicted 292
7 SASI_Rn02_00211892 predicted 419
8 SASI_Rn02_00211893 predicted 256
9 SASI_Rn02_00211894 predicted 321
10 SASI_Rn02_00211895 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174099 predicted 459
2 SASI_Mm01_00174100 predicted 214
3 SASI_Mm01_00174101 predicted 272
4 SASI_Mm01_00174102 predicted 440
5 SASI_Mm01_00174103 predicted 233
6 SASI_Mm01_00174104 predicted 307
7 SASI_Mm01_00174105 predicted 426
8 SASI_Mm01_00174107 predicted 287
9 SASI_Mm02_00315334 predicted 313
10 SASI_Mm02_00315335 predicted 298
11 SASI_Mm01_00174098 predicted 393
12 SASI_Mm01_00174106 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009095
VALIDATED
RPS5 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-275s1c1
Sequence:CCGGGCGCCTTACTAACTCCATGATCTCGAGATCATGGAGTTAGTAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-277s1c1
Sequence:CCGGGCCTTACTAACTCCATGATGACTCGAGTCATCATGGAGTTAGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-144s1c1
Sequence:CCGGGACGTGCAGATCAACGATATTCTCGAGAATATCGTTGATCTGCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009095.1-143s1c1
Sequence:CCGGTGACGTGCAGATCAACGATATCTCGAGATATCGTTGATCTGCACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-398s1c1
Sequence:CCGGCCTGGTGAATGCTATCATCAACTCGAGTTGATGATAGCATTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-322s21c1
Sequence:CCGGAGCTCATGACTGTGCGAATTGCTCGAGCAATTCGCACAGTCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-582s21c1
Sequence:CCGGCTTGCAGATGAGCTCATTAATCTCGAGATTAATGAGCTCATCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-275s21c1
Sequence:CCGGGCGCCTTACTAACTCCATGATCTCGAGATCATGGAGTTAGTAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-144s21c1
Sequence:CCGGGACGTGCAGATCAACGATATTCTCGAGAATATCGTTGATCTGCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-398s21c1
Sequence:CCGGCCTGGTGAATGCTATCATCAACTCGAGTTGATGATAGCATTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009095
VALIDATED
RPS5 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-275s1c1
Sequence:CCGGGCGCCTTACTAACTCCATGATCTCGAGATCATGGAGTTAGTAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-277s1c1
Sequence:CCGGGCCTTACTAACTCCATGATGACTCGAGTCATCATGGAGTTAGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-144s1c1
Sequence:CCGGGACGTGCAGATCAACGATATTCTCGAGAATATCGTTGATCTGCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009095.1-143s1c1
Sequence:CCGGTGACGTGCAGATCAACGATATCTCGAGATATCGTTGATCTGCACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-398s1c1
Sequence:CCGGCCTGGTGAATGCTATCATCAACTCGAGTTGATGATAGCATTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-322s21c1
Sequence:CCGGAGCTCATGACTGTGCGAATTGCTCGAGCAATTCGCACAGTCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-582s21c1
Sequence:CCGGCTTGCAGATGAGCTCATTAATCTCGAGATTAATGAGCTCATCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-275s21c1
Sequence:CCGGGCGCCTTACTAACTCCATGATCTCGAGATCATGGAGTTAGTAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-144s21c1
Sequence:CCGGGACGTGCAGATCAACGATATTCTCGAGAATATCGTTGATCTGCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-398s21c1
Sequence:CCGGCCTGGTGAATGCTATCATCAACTCGAGTTGATGATAGCATTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009095
VALIDATED
RPS5 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-275s1c1
Sequence:CCGGGCGCCTTACTAACTCCATGATCTCGAGATCATGGAGTTAGTAAGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-277s1c1
Sequence:CCGGGCCTTACTAACTCCATGATGACTCGAGTCATCATGGAGTTAGTAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-144s1c1
Sequence:CCGGGACGTGCAGATCAACGATATTCTCGAGAATATCGTTGATCTGCACGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009095.1-143s1c1
Sequence:CCGGTGACGTGCAGATCAACGATATCTCGAGATATCGTTGATCTGCACGTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000104241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009095.1-398s1c1
Sequence:CCGGCCTGGTGAATGCTATCATCAACTCGAGTTGATGATAGCATTCACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-322s21c1
Sequence:CCGGAGCTCATGACTGTGCGAATTGCTCGAGCAATTCGCACAGTCATGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-582s21c1
Sequence:CCGGCTTGCAGATGAGCTCATTAATCTCGAGATTAATGAGCTCATCTGCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-275s21c1
Sequence:CCGGGCGCCTTACTAACTCCATGATCTCGAGATCATGGAGTTAGTAAGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-144s21c1
Sequence:CCGGGACGTGCAGATCAACGATATTCTCGAGAATATCGTTGATCTGCACGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009095.1-398s21c1
Sequence:CCGGCCTGGTGAATGCTATCATCAACTCGAGTTGATGATAGCATTCACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009
VALIDATED
RPS5 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-257s21c1
Sequence:CCGGGCAAAGCTCAGTGTCCCATTGCTCGAGCAATGGGACACTGAGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-158s1c1
Sequence:CCGGGCAGGATTACATTGCAGTGAACTCGAGTTCACTGCAATGTAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-126s1c1
Sequence:CCGGACCGATGATGTGCAGATCAATCTCGAGATTGATCTGCACATCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009.2-266s1c1
Sequence:CCGGCCTCACTAACTCCATGATGATCTCGAGATCATCATGGAGTTAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009.2-263s1c1
Sequence:CCGGGCGCCTCACTAACTCCATGATCTCGAGATCATGGAGTTAGTGAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-543s1c1
Sequence:CCGGCGGAACATTAAGACCATTGCTCTCGAGAGCAATGGTCTTAATGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-317s21c1
Sequence:CCGGACAACGGCAAGAAGCTCATGACTCGAGTCATGAGCTTCTTGCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001009.3-404s21c1
Sequence:CCGGTCCTGGTGAACGCCATCATCACTCGAGTGATGATGGCGTTCACCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001009.3-145s21c1
Sequence:CCGGACCGATGATGTGCAGATCAATCTCGAGATTGATCTGCACATCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-282s21c1
Sequence:CCGGGCGCCTCACTAACTCCATGATCTCGAGATCATGGAGTTAGTGAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-353s21c1
Sequence:CCGGAGCATGCCTTCGAGATCATACCTCGAGGTATGATCTCGAAGGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009
VALIDATED
RPS5 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-257s21c1
Sequence:CCGGGCAAAGCTCAGTGTCCCATTGCTCGAGCAATGGGACACTGAGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-158s1c1
Sequence:CCGGGCAGGATTACATTGCAGTGAACTCGAGTTCACTGCAATGTAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-126s1c1
Sequence:CCGGACCGATGATGTGCAGATCAATCTCGAGATTGATCTGCACATCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009.2-266s1c1
Sequence:CCGGCCTCACTAACTCCATGATGATCTCGAGATCATCATGGAGTTAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009.2-263s1c1
Sequence:CCGGGCGCCTCACTAACTCCATGATCTCGAGATCATGGAGTTAGTGAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-543s1c1
Sequence:CCGGCGGAACATTAAGACCATTGCTCTCGAGAGCAATGGTCTTAATGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-317s21c1
Sequence:CCGGACAACGGCAAGAAGCTCATGACTCGAGTCATGAGCTTCTTGCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001009.3-404s21c1
Sequence:CCGGTCCTGGTGAACGCCATCATCACTCGAGTGATGATGGCGTTCACCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001009.3-145s21c1
Sequence:CCGGACCGATGATGTGCAGATCAATCTCGAGATTGATCTGCACATCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-282s21c1
Sequence:CCGGGCGCCTCACTAACTCCATGATCTCGAGATCATGGAGTTAGTGAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-353s21c1
Sequence:CCGGAGCATGCCTTCGAGATCATACCTCGAGGTATGATCTCGAAGGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009
VALIDATED
RPS5 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-257s21c1
Sequence:CCGGGCAAAGCTCAGTGTCCCATTGCTCGAGCAATGGGACACTGAGCTTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-158s1c1
Sequence:CCGGGCAGGATTACATTGCAGTGAACTCGAGTTCACTGCAATGTAATCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-126s1c1
Sequence:CCGGACCGATGATGTGCAGATCAATCTCGAGATTGATCTGCACATCATCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009.2-266s1c1
Sequence:CCGGCCTCACTAACTCCATGATGATCTCGAGATCATCATGGAGTTAGTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009.2-263s1c1
Sequence:CCGGGCGCCTCACTAACTCCATGATCTCGAGATCATGGAGTTAGTGAGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001009.2-543s1c1
Sequence:CCGGCGGAACATTAAGACCATTGCTCTCGAGAGCAATGGTCTTAATGTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000369936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-317s21c1
Sequence:CCGGACAACGGCAAGAAGCTCATGACTCGAGTCATGAGCTTCTTGCCGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000369867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001009.3-404s21c1
Sequence:CCGGTCCTGGTGAACGCCATCATCACTCGAGTGATGATGGCGTTCACCAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000333509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001009.3-145s21c1
Sequence:CCGGACCGATGATGTGCAGATCAATCTCGAGATTGATCTGCACATCATCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000333448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-282s21c1
Sequence:CCGGGCGCCTCACTAACTCCATGATCTCGAGATCATGGAGTTAGTGAGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009.3-353s21c1
Sequence:CCGGAGCATGCCTTCGAGATCATACCTCGAGGTATGATCTCGAAGGCATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???