EMAIL THIS PAGE TO A FRIEND

RPS6KA2

ribosomal protein S6 kinase, 90kDa, polypeptide 2

156 Gene Product Result for
Synonyms: HU-2 MAPKAPK1C RSK RSK3 S6K-alpha S6K-alpha2 p90-RSK3 pp90RSK3
Gene ID:
Human(6196) Summary: This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(20112) ribosomal protein S6 kinase, polypeptide 2
Rat(117269) ribosomal protein S6 kinase polypeptide 2
Zebrafish(571285) ribosomal protein S6 kinase, 90kDa, polypeptide 2
chicken(421570) ribosomal protein S6 kinase, 90kDa, polypeptide 2
dog(612448) ribosomal protein S6 kinase, 90kDa, polypeptide 2
domestic cat(101099466) ribosomal protein S6 kinase, 90kDa, polypeptide 2
Horse(100050176) ribosomal protein S6 kinase, 90kDa, polypeptide 2
domestic guinea pig(100729439) ribosomal protein S6 kinase, 90kDa, polypeptide 2
cow(517953) ribosomal protein S6 kinase, 90kDa, polypeptide 2
sheep(101114530) ribosomal protein S6 kinase, 90kDa, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006932 Rosetta Predictions human pricing
NM_021135 Rosetta Predictions human pricing
XM_001058582 Rosetta Predictions rat pricing
XM_001064184 Rosetta Predictions rat pricing
XM_001064230 Rosetta Predictions rat pricing
XM_001064287 Rosetta Predictions rat pricing
XM_001064346 Rosetta Predictions rat pricing
XM_001064394 Rosetta Predictions rat pricing
XM_001064450 Rosetta Predictions rat pricing
XM_341758 Rosetta Predictions rat pricing
NM_011299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246126 predicted 1453
2 SASI_Hs01_00246127 predicted 2069
3 SASI_Hs01_00246128 predicted 443
4 SASI_Hs01_00246129 predicted 1563
5 SASI_Hs01_00246130 predicted 1044
6 SASI_Hs01_00246131 predicted 1313
7 SASI_Hs01_00246132 predicted 763
8 SASI_Hs02_00305135 predicted 509
9 SASI_Hs01_00246133 predicted 1736
10 SASI_Hs02_00305136 predicted 521
11 SASI_Hs01_00246124 predicted 1248
12 SASI_Hs01_00246125 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148164 predicted 1527
2 SASI_Hs01_00148165 predicted 2145
3 SASI_Hs01_00148166 predicted 525
4 SASI_Hs01_00148167 predicted 1650
5 SASI_Hs01_00148168 predicted 1127
6 SASI_Hs01_00148169 predicted 1396
7 SASI_Hs01_00148170 predicted 836
8 SASI_Hs02_00354657 predicted 590
9 SASI_Hs01_00148171 predicted 1817
10 SASI_Hs02_00354658 predicted 607
11 SASI_Hs01_00148162 predicted 1337
12 SASI_Hs01_00148163 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290217 predicted 605
2 SASI_Rn02_00290218 predicted 350
3 SASI_Rn02_00290219 predicted 841
4 SASI_Rn02_00290220 predicted 350
5 SASI_Rn02_00290221 predicted 822
6 SASI_Rn02_00290222 predicted 401
7 SASI_Rn02_00290223 predicted 650
8 SASI_Rn02_00290224 predicted 336
9 SASI_Rn02_00290225 predicted 660
10 SASI_Rn02_00290226 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309599 predicted 347
2 SASI_Rn02_00309600 predicted 1639
3 SASI_Rn02_00309601 predicted 1687
4 SASI_Rn02_00309602 predicted 353
5 SASI_Rn02_00309603 predicted 1223
6 SASI_Rn02_00309604 predicted 1691
7 SASI_Rn02_00309605 predicted 402
8 SASI_Rn02_00309606 predicted 1621
9 SASI_Rn02_00309607 predicted 2009
10 SASI_Rn02_00309608 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309744 predicted 624
2 SASI_Rn02_00309745 predicted 1920
3 SASI_Rn02_00309746 predicted 1975
4 SASI_Rn02_00309747 predicted 635
5 SASI_Rn02_00309748 predicted 1505
6 SASI_Rn02_00309749 predicted 1977
7 SASI_Rn02_00309750 predicted 681
8 SASI_Rn02_00309751 predicted 1906
9 SASI_Rn02_00309752 predicted 2284
10 SASI_Rn02_00309753 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309927 predicted 560
2 SASI_Rn02_00309928 predicted 274
3 SASI_Rn02_00309929 predicted 564
4 SASI_Rn02_00309930 predicted 282
5 SASI_Rn02_00309931 predicted 607
6 SASI_Rn02_00309932 predicted 1885
7 SASI_Rn02_00309933 predicted 543
8 SASI_Rn02_00309934 predicted 1438
9 SASI_Rn02_00309935 predicted 1809
10 SASI_Rn02_00309936 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310101 predicted 560
2 SASI_Rn02_00310102 predicted 1815
3 SASI_Rn02_00310103 predicted 273
4 SASI_Rn02_00310104 predicted 1873
5 SASI_Rn02_00310105 predicted 563
6 SASI_Rn02_00310106 predicted 1403
7 SASI_Rn02_00310107 predicted 286
8 SASI_Rn02_00310108 predicted 1801
9 SASI_Rn02_00310109 predicted 2186
10 SASI_Rn02_00310110 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310284 predicted 558
2 SASI_Rn02_00310285 predicted 1810
3 SASI_Rn02_00310286 predicted 273
4 SASI_Rn02_00310287 predicted 1870
5 SASI_Rn02_00310288 predicted 560
6 SASI_Rn02_00310289 predicted 1876
7 SASI_Rn02_00310290 predicted 282
8 SASI_Rn02_00310291 predicted 1806
9 SASI_Rn02_00310292 predicted 2188
10 SASI_Rn02_00310293 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310555 predicted 559
2 SASI_Rn02_00310556 predicted 1847
3 SASI_Rn02_00310557 predicted 278
4 SASI_Rn02_00310558 predicted 1902
5 SASI_Rn02_00310559 predicted 562
6 SASI_Rn02_00310560 predicted 1438
7 SASI_Rn02_00310561 predicted 284
8 SASI_Rn02_00310562 predicted 1831
9 SASI_Rn02_00310563 predicted 2223
10 SASI_Rn02_00310564 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393310 predicted 807
2 SASI_Rn02_00393311 predicted 547
3 SASI_Rn02_00393312 predicted 1043
4 SASI_Rn02_00393313 predicted 473
5 SASI_Rn02_00393314 predicted 261
6 SASI_Rn02_00393315 predicted 554
7 SASI_Rn02_00393316 predicted 1020
8 SASI_Rn02_00393317 predicted 282
9 SASI_Rn02_00393318 predicted 849
10 SASI_Rn02_00393319 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059966 predicted 1196
2 SASI_Mm01_00059967 predicted 1462
3 SASI_Mm01_00059968 predicted 549
4 SASI_Mm01_00059970 predicted 1420
5 SASI_Mm01_00059971 predicted 539
6 SASI_Mm01_00059972 predicted 2210
7 SASI_Mm01_00059973 predicted 1840
8 SASI_Mm01_00059974 predicted 1753
9 SASI_Mm01_00059975 predicted 1830
10 SASI_Mm02_00320372 predicted 329
11 SASI_Mm01_00059969 predicted 2426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021135
VALIDATED
RPS6KA2 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-1929s21c1
Sequence:CCGGACCCTGCTACACGGCCAATTTCTCGAGAAATTGGCCGTGTAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-2307s21c1
Sequence:CCGGCGCCACCTACTTTGCTCTAAACTCGAGTTTAGAGCAAAGTAGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-2137s21c1
Sequence:CCGGTCGATATCTGACGCAGCTAAACTCGAGTTTAGCTGCGTCAGATATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021135.4-4617s1c1
Sequence:CCGGGCTCTGTCCTTACATGTATTTCTCGAGAAATACATGTAAGGACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1319s1c1
Sequence:CCGGCAAACGCTCATCACCTGTTTACTCGAGTAAACAGGTGATGAGCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1543s1c1
Sequence:CCGGGCCGTGAAGATCATTGATAAGCTCGAGCTTATCAATGATCTTCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-1136s21c1
Sequence:CCGGTTGACGGAGTGGAGGAAATTACTCGAGTAATTTCCTCCACTCCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021135.3-3042s1c1
Sequence:CCGGCCAGATTCAAATGAGGAGTAACTCGAGTTACTCCTCATTTGAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021135.3-483s1c1
Sequence:CCGGGCCATGAAGGTCCTTAAGAAACTCGAGTTTCTTAAGGACCTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021135.3-573s1c1
Sequence:CCGGCCCTTCATTGTGAAGCTTCATCTCGAGATGAAGCTTCACAATGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.3-2306s1c1
Sequence:CCGGCGCCACCTACTTTGCTCTAAACTCGAGTTTAGAGCAAAGTAGGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.3-1654s1c1
Sequence:CCGGGCAAGTTTGTGTACCTGGTAACTCGAGTTACCAGGTACACAAACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1990s1c1
Sequence:CCGGGCGTGTGACATCTGGAGTTTGCTCGAGCAAACTCCAGATGTCACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021135
VALIDATED
RPS6KA2 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-1929s21c1
Sequence:CCGGACCCTGCTACACGGCCAATTTCTCGAGAAATTGGCCGTGTAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-2307s21c1
Sequence:CCGGCGCCACCTACTTTGCTCTAAACTCGAGTTTAGAGCAAAGTAGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-2137s21c1
Sequence:CCGGTCGATATCTGACGCAGCTAAACTCGAGTTTAGCTGCGTCAGATATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021135.4-4617s1c1
Sequence:CCGGGCTCTGTCCTTACATGTATTTCTCGAGAAATACATGTAAGGACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1319s1c1
Sequence:CCGGCAAACGCTCATCACCTGTTTACTCGAGTAAACAGGTGATGAGCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1543s1c1
Sequence:CCGGGCCGTGAAGATCATTGATAAGCTCGAGCTTATCAATGATCTTCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-1136s21c1
Sequence:CCGGTTGACGGAGTGGAGGAAATTACTCGAGTAATTTCCTCCACTCCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021135.3-3042s1c1
Sequence:CCGGCCAGATTCAAATGAGGAGTAACTCGAGTTACTCCTCATTTGAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021135.3-483s1c1
Sequence:CCGGGCCATGAAGGTCCTTAAGAAACTCGAGTTTCTTAAGGACCTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021135.3-573s1c1
Sequence:CCGGCCCTTCATTGTGAAGCTTCATCTCGAGATGAAGCTTCACAATGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.3-2306s1c1
Sequence:CCGGCGCCACCTACTTTGCTCTAAACTCGAGTTTAGAGCAAAGTAGGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.3-1654s1c1
Sequence:CCGGGCAAGTTTGTGTACCTGGTAACTCGAGTTACCAGGTACACAAACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1990s1c1
Sequence:CCGGGCGTGTGACATCTGGAGTTTGCTCGAGCAAACTCCAGATGTCACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021135
VALIDATED
RPS6KA2 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-1929s21c1
Sequence:CCGGACCCTGCTACACGGCCAATTTCTCGAGAAATTGGCCGTGTAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-2307s21c1
Sequence:CCGGCGCCACCTACTTTGCTCTAAACTCGAGTTTAGAGCAAAGTAGGTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-2137s21c1
Sequence:CCGGTCGATATCTGACGCAGCTAAACTCGAGTTTAGCTGCGTCAGATATCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021135.4-4617s1c1
Sequence:CCGGGCTCTGTCCTTACATGTATTTCTCGAGAAATACATGTAAGGACAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1319s1c1
Sequence:CCGGCAAACGCTCATCACCTGTTTACTCGAGTAAACAGGTGATGAGCGTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1543s1c1
Sequence:CCGGGCCGTGAAGATCATTGATAAGCTCGAGCTTATCAATGATCTTCACGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021135.4-1136s21c1
Sequence:CCGGTTGACGGAGTGGAGGAAATTACTCGAGTAATTTCCTCCACTCCGTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021135.3-3042s1c1
Sequence:CCGGCCAGATTCAAATGAGGAGTAACTCGAGTTACTCCTCATTTGAATCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021135.3-483s1c1
Sequence:CCGGGCCATGAAGGTCCTTAAGAAACTCGAGTTTCTTAAGGACCTTCATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021135.3-573s1c1
Sequence:CCGGCCCTTCATTGTGAAGCTTCATCTCGAGATGAAGCTTCACAATGAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.3-2306s1c1
Sequence:CCGGCGCCACCTACTTTGCTCTAAACTCGAGTTTAGAGCAAAGTAGGTGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.3-1654s1c1
Sequence:CCGGGCAAGTTTGTGTACCTGGTAACTCGAGTTACCAGGTACACAAACTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_021135.4-1990s1c1
Sequence:CCGGGCGTGTGACATCTGGAGTTTGCTCGAGCAAACTCCAGATGTCACACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011299
RPS6KA2 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000022711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-627s1c1
Sequence:CCGGGCTTTCCAAAGAGGTGATGTTCTCGAGAACATCACCTCTTTGGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-1779s1c1
Sequence:CCGGGAAACCAAGTAACATTCTGTACTCGAGTACAGAATGTTACTTGGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-2351s1c1
Sequence:CCGGGCATGAAGAGACTCACGTCTACTCGAGTAGACGTGAGTCTCTTCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011299
RPS6KA2 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000022711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-627s1c1
Sequence:CCGGGCTTTCCAAAGAGGTGATGTTCTCGAGAACATCACCTCTTTGGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-1779s1c1
Sequence:CCGGGAAACCAAGTAACATTCTGTACTCGAGTACAGAATGTTACTTGGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-2351s1c1
Sequence:CCGGGCATGAAGAGACTCACGTCTACTCGAGTAGACGTGAGTCTCTTCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011299
RPS6KA2 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000022711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-627s1c1
Sequence:CCGGGCTTTCCAAAGAGGTGATGTTCTCGAGAACATCACCTCTTTGGAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-1779s1c1
Sequence:CCGGGAAACCAAGTAACATTCTGTACTCGAGTACAGAATGTTACTTGGTTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011299.3-2351s1c1
Sequence:CCGGGCATGAAGAGACTCACGTCTACTCGAGTAGACGTGAGTCTCTTCATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)