EMAIL THIS PAGE TO A FRIEND

RPS6KB1

ribosomal protein S6 kinase, 70kDa, polypeptide 1

336 Gene Product Result for
Synonyms: PS6K S6K S6K-beta-1 S6K1 STK14A p70 S6KA p70(S6K)-alpha p70-S6K p70-alpha
UniProtKB ID: P23443
Gene ID:
Human(6198) Summary: This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]
Mouse(72508) ribosomal protein S6 kinase, polypeptide 1
Rat(83840) ribosomal protein S6 kinase, polypeptide 1
chicken(417637) ribosomal protein S6 kinase, 70kDa, polypeptide 1
domestic cat(101092561) ribosomal protein S6 kinase, 70kDa, polypeptide 1
Horse(100057481) ribosomal protein S6 kinase, 70kDa, polypeptide 1
dog(480580) ribosomal protein S6 kinase, 70kDa, polypeptide 1
cow(404181) ribosomal protein S6 kinase, 70kDa, polypeptide 1
sheep(101107371) ribosomal protein S6 kinase, 70kDa, polypeptide 1
domestic guinea pig(100727216) ribosomal protein S6 kinase, 70kDa, polypeptide 1
naked mole-rat(101724077) ribosomal protein S6 kinase, 70kDa, polypeptide 1
Domestic Rabbit(100009260) ribosomal protein S6 kinase, 70kDa, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502683 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502684 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502685 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4502686 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502687 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4502688 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502689 Anti-p70 S6 Kinase antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4502690 Anti-p70 S6 Kinase, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB2500736 Anti-P70S6K/RPS6KB1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rabbit, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503956 Anti-phospho-p70 S6 Kinase (pSer371) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301518 Anti-phospho-p70 S6 Kinase (pSer371) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4504507 Anti-phospho-p70 S6 Kinase (pSer411) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4503958 Anti-phospho-p70 S6 Kinase (pSer418) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504508 Anti-phospho-p70 S6 Kinase (pSer424) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503955 Anti-phospho-p70 S6 Kinase (pThr229) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503957 Anti-phospho-p70 S6 Kinase (pThr389) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301471 Anti-phospho-p70 S6 Kinase (pThr389/412) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504509 Anti-phospho-p70 S6 Kinase (pThr421) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300202 Anti-phospho-RPS6KB1 (pThr421) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
S6311 Anti-phospho-S6-Kinase (pThr389) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
western blot pricing
S6436 Anti-phospho-S6-Kinase (pThr421/pSer424) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunoprecipitation (IP), western blot pricing
R9405 Anti-RPS6KB1 (496-510) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300444 Anti-RPS6KB1 (Ab-389) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB4300515 Anti-RPS6KB1 (Ab-411) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300500 Anti-RPS6KB1 (Ab-421) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300527 Anti-RPS6KB1 (Ab-424) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1412617 ANTI-RPS6KB1 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, western blot pricing
SAB1412626 ANTI-RPS6KB1 antibody produced in mouse clone 4H4, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, western blot pricing
HPA039442 Anti-RPS6KB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
S4047 Anti-S6 Kinase antibody produced in rabbit whole antiserum human, rat, mouse
microarray, western blot pricing
SAB4502691 Anti-S6K antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0006198M1 Monoclonal Anti-RPS6KB1 antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100377 Monoclonal Anti-RPS6KB1 antibody produced in mouse clone RPS6KB1-A323, culture supernatant human
western blot pricing
SAB4100378 Monoclonal Anti-RPS6KB1 antibody produced in mouse clone RPS6KB1-B323, culture supernatant human
western blot pricing
SAB1404335 Monoclonal Anti-RPS6KB1, (C-terminal) antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0143 PF-4708671 ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107461 MISSION® esiRNA esiRNA human RPS6KB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003161 siRNAs that have been validated in the lab human pricing
NM_031985 Rosetta Predictions rat pricing
NM_001114334 Rosetta Predictions mouse pricing
NM_028259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003161 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148597 validated 481
1 SASI_Hs01_00148596 validated 656
2 SASI_Hs01_00148595 predicted 903
3 SASI_Hs01_00148601 predicted 554
4 SASI_Hs01_00148598 predicted 377
5 SASI_Hs01_00148600 predicted 1584
6 SASI_Hs02_00335169 predicted 1232
7 SASI_Hs01_00148602 predicted 579
8 SASI_Hs01_00148603 predicted 1200
9 SASI_Hs02_00335170 predicted 794
10 SASI_Hs01_00148599 predicted 651
11 SASI_Hs01_00148604 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107755 predicted 411
2 SASI_Rn01_00107756 predicted 480
3 SASI_Rn01_00107757 predicted 1218
4 SASI_Rn01_00107758 predicted 400
5 SASI_Rn01_00107759 predicted 193
6 SASI_Rn01_00107760 predicted 1200
7 SASI_Rn01_00107761 predicted 1499
8 SASI_Rn01_00107763 predicted 1150
9 SASI_Rn01_00107764 predicted 1115
10 SASI_Rn02_00265383 predicted 290
11 SASI_Rn01_00107762 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308550 predicted 429
2 SASI_Mm02_00308551 predicted 294
3 SASI_Mm02_00308552 predicted 279
4 SASI_Mm02_00308553 predicted 311
5 SASI_Mm02_00308554 predicted 432
6 SASI_Mm02_00308555 predicted 290
7 SASI_Mm02_00308556 predicted 375
8 SASI_Mm02_00308557 predicted 293
9 SASI_Mm02_00308558 predicted 281
10 SASI_Mm02_00308559 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333616 predicted 435
2 SASI_Mm02_00333617 predicted 295
3 SASI_Mm01_00124582 predicted 274
4 SASI_Mm02_00333618 predicted 310
5 SASI_Mm02_00333619 predicted 430
6 SASI_Mm02_00333620 predicted 292
7 SASI_Mm01_00124586 predicted 375
8 SASI_Mm02_00333621 predicted 301
9 SASI_Mm02_00333622 predicted 282
10 SASI_Mm02_00333623 predicted 443
11 SASI_Mm01_00124577 predicted 1020
12 SASI_Mm01_00124578 predicted 680
13 SASI_Mm01_00124579 predicted 735
14 SASI_Mm01_00124580 predicted 827
15 SASI_Mm01_00124581 predicted 726
16 SASI_Mm01_00124583 predicted 950
17 SASI_Mm01_00124584 predicted 1011
18 SASI_Mm01_00124585 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003161
VALIDATED
RPS6KB1 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 70kDa, polypeptide 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1417s1c1
Sequence:CCGGAGCACAGCAAATCCTCAGACACTCGAGTGTCTGAGGATTTGCTGTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.x-1501s1c1
Sequence:CCGGGCATCGGCACCACTTCCAATACTCGAGTATTGGAAGTGGTGCCGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-461s21c1
Sequence:CCGGTTTGCCATGAAGGTGCTTAAACTCGAGTTTAAGCACCTTCATGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.x-383s1c1
Sequence:CCGGTATTTGCCATGAAGGTGCTTACTCGAGTAAGCACCTTCATGGCAAATATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1561s1c1
Sequence:CCGGCCCATGATCTCCAAACGGCCACTCGAGTGGCCGTTTGGAGATCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1493s21c1
Sequence:CCGGAGCACAGCAAATCCTCAGACACTCGAGTGTCTGAGGATTTGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1844s1c1
Sequence:CCGGGCGACATCTTTCTCAACCTTACTCGAGTAAGGTTGAGAAAGATGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1397s21c1
Sequence:CCGGATCCGATCACCTCGAAGATTTCTCGAGAAATCTTCGAGGTGATCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003161.2-1919s21c1
Sequence:CCGGGCGACATCTTCTCAACCTTATCTCGAGATAAGGTTGAGAAGATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003161.2-2066s1c1
Sequence:CCGGCCTATAATACTTGCAACTAAGCTCGAGCTTAGTTGCAAGTATTATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.2-764s1c1
Sequence:CCGGCCGGAGAATATCATGCTTAATCTCGAGATTAAGCATGATATTCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.2-787s1c1
Sequence:CCGGCCAAGGTCATGTGAAACTAACCTCGAGGTTAGTTTCACATGACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.2-1222s1c1
Sequence:CCGGGCAATCTGAAGAGGATGTAAGCTCGAGCTTACATCCTCTTCAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003161.2-4656s1c1
Sequence:CCGGGCATGTATGATACTCCATAAACTCGAGTTTATGGAGTATCATACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1637s21c1
Sequence:CCGGCCCATGATCTCCAAACGGCCACTCGAGTGGCCGTTTGGAGATCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003161
VALIDATED
RPS6KB1 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 70kDa, polypeptide 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1417s1c1
Sequence:CCGGAGCACAGCAAATCCTCAGACACTCGAGTGTCTGAGGATTTGCTGTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.x-1501s1c1
Sequence:CCGGGCATCGGCACCACTTCCAATACTCGAGTATTGGAAGTGGTGCCGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-461s21c1
Sequence:CCGGTTTGCCATGAAGGTGCTTAAACTCGAGTTTAAGCACCTTCATGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.x-383s1c1
Sequence:CCGGTATTTGCCATGAAGGTGCTTACTCGAGTAAGCACCTTCATGGCAAATATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1561s1c1
Sequence:CCGGCCCATGATCTCCAAACGGCCACTCGAGTGGCCGTTTGGAGATCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1493s21c1
Sequence:CCGGAGCACAGCAAATCCTCAGACACTCGAGTGTCTGAGGATTTGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1844s1c1
Sequence:CCGGGCGACATCTTTCTCAACCTTACTCGAGTAAGGTTGAGAAAGATGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1397s21c1
Sequence:CCGGATCCGATCACCTCGAAGATTTCTCGAGAAATCTTCGAGGTGATCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003161.2-1919s21c1
Sequence:CCGGGCGACATCTTCTCAACCTTATCTCGAGATAAGGTTGAGAAGATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003161.2-2066s1c1
Sequence:CCGGCCTATAATACTTGCAACTAAGCTCGAGCTTAGTTGCAAGTATTATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.2-764s1c1
Sequence:CCGGCCGGAGAATATCATGCTTAATCTCGAGATTAAGCATGATATTCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.2-787s1c1
Sequence:CCGGCCAAGGTCATGTGAAACTAACCTCGAGGTTAGTTTCACATGACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.2-1222s1c1
Sequence:CCGGGCAATCTGAAGAGGATGTAAGCTCGAGCTTACATCCTCTTCAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003161.2-4656s1c1
Sequence:CCGGGCATGTATGATACTCCATAAACTCGAGTTTATGGAGTATCATACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1637s21c1
Sequence:CCGGCCCATGATCTCCAAACGGCCACTCGAGTGGCCGTTTGGAGATCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003161
VALIDATED
RPS6KB1 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 70kDa, polypeptide 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1417s1c1
Sequence:CCGGAGCACAGCAAATCCTCAGACACTCGAGTGTCTGAGGATTTGCTGTGCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.x-1501s1c1
Sequence:CCGGGCATCGGCACCACTTCCAATACTCGAGTATTGGAAGTGGTGCCGATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-461s21c1
Sequence:CCGGTTTGCCATGAAGGTGCTTAAACTCGAGTTTAAGCACCTTCATGGCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.x-383s1c1
Sequence:CCGGTATTTGCCATGAAGGTGCTTACTCGAGTAAGCACCTTCATGGCAAATATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1561s1c1
Sequence:CCGGCCCATGATCTCCAAACGGCCACTCGAGTGGCCGTTTGGAGATCATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1493s21c1
Sequence:CCGGAGCACAGCAAATCCTCAGACACTCGAGTGTCTGAGGATTTGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.x-1844s1c1
Sequence:CCGGGCGACATCTTTCTCAACCTTACTCGAGTAAGGTTGAGAAAGATGTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1397s21c1
Sequence:CCGGATCCGATCACCTCGAAGATTTCTCGAGAAATCTTCGAGGTGATCGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003161.2-1919s21c1
Sequence:CCGGGCGACATCTTCTCAACCTTATCTCGAGATAAGGTTGAGAAGATGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003161.2-2066s1c1
Sequence:CCGGCCTATAATACTTGCAACTAAGCTCGAGCTTAGTTGCAAGTATTATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003161.2-764s1c1
Sequence:CCGGCCGGAGAATATCATGCTTAATCTCGAGATTAAGCATGATATTCTCCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.2-787s1c1
Sequence:CCGGCCAAGGTCATGTGAAACTAACCTCGAGGTTAGTTTCACATGACCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003161.2-1222s1c1
Sequence:CCGGGCAATCTGAAGAGGATGTAAGCTCGAGCTTACATCCTCTTCAGATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003161.2-4656s1c1
Sequence:CCGGGCATGTATGATACTCCATAAACTCGAGTTTATGGAGTATCATACATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003161.2-1637s21c1
Sequence:CCGGCCCATGATCTCCAAACGGCCACTCGAGTGGCCGTTTGGAGATCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028259
VALIDATED
RPS6KB1 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 70kDa, polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-295s21c1
Sequence:CCGGGCATGGAACATTGTGAGAAATCTCGAGATTTCTCACAATGTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-526s1c1
Sequence:CCGGCCCTTTCATTGTGGACCTGATCTCGAGATCAGGTCCACAATGAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-616s1c1
Sequence:CCGGGCAGTTAGAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTCTAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028259.1-720s1c1
Sequence:CCGGGCAGTCTTAGGGAGGTGATAACTCGAGTTATCACCTCCCTAAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-264s1c1
Sequence:CCGGGCATGGAACATTGTGAGAAATCTCGAGATTTCTCACAATGTTCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-963s1c1
Sequence:CCGGACATTGTTACACAGCCAGTATCTCGAGATACTGGCTGTGTAACAATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-557s21c1
Sequence:CCGGCCCTTTCATTGTGGACCTGATCTCGAGATCAGGTCCACAATGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-994s21c1
Sequence:CCGGACATTGTTACACAGCCAGTATCTCGAGATACTGGCTGTGTAACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-647s21c1
Sequence:CCGGGCAGTTAGAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTCTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028259
VALIDATED
RPS6KB1 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 70kDa, polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-295s21c1
Sequence:CCGGGCATGGAACATTGTGAGAAATCTCGAGATTTCTCACAATGTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-526s1c1
Sequence:CCGGCCCTTTCATTGTGGACCTGATCTCGAGATCAGGTCCACAATGAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-616s1c1
Sequence:CCGGGCAGTTAGAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTCTAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028259.1-720s1c1
Sequence:CCGGGCAGTCTTAGGGAGGTGATAACTCGAGTTATCACCTCCCTAAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-264s1c1
Sequence:CCGGGCATGGAACATTGTGAGAAATCTCGAGATTTCTCACAATGTTCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-963s1c1
Sequence:CCGGACATTGTTACACAGCCAGTATCTCGAGATACTGGCTGTGTAACAATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-557s21c1
Sequence:CCGGCCCTTTCATTGTGGACCTGATCTCGAGATCAGGTCCACAATGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-994s21c1
Sequence:CCGGACATTGTTACACAGCCAGTATCTCGAGATACTGGCTGTGTAACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-647s21c1
Sequence:CCGGGCAGTTAGAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTCTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028259
VALIDATED
RPS6KB1 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 70kDa, polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-295s21c1
Sequence:CCGGGCATGGAACATTGTGAGAAATCTCGAGATTTCTCACAATGTTCCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-526s1c1
Sequence:CCGGCCCTTTCATTGTGGACCTGATCTCGAGATCAGGTCCACAATGAAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-616s1c1
Sequence:CCGGGCAGTTAGAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTCTAACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028259.1-720s1c1
Sequence:CCGGGCAGTCTTAGGGAGGTGATAACTCGAGTTATCACCTCCCTAAGACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-264s1c1
Sequence:CCGGGCATGGAACATTGTGAGAAATCTCGAGATTTCTCACAATGTTCCATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028259.1-963s1c1
Sequence:CCGGACATTGTTACACAGCCAGTATCTCGAGATACTGGCTGTGTAACAATGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-557s21c1
Sequence:CCGGCCCTTTCATTGTGGACCTGATCTCGAGATCAGGTCCACAATGAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-994s21c1
Sequence:CCGGACATTGTTACACAGCCAGTATCTCGAGATACTGGCTGTGTAACAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028259.4-647s21c1
Sequence:CCGGGCAGTTAGAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTCTAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)