EMAIL THIS PAGE TO A FRIEND

RPS6KB2

ribosomal protein S6 kinase, 70kDa, polypeptide 2

81 Gene Product Result for
Synonyms: KLS P70-beta P70-beta-1 P70-beta-2 S6K-beta2 S6K2 SRK STK14B p70(S6K)-beta p70S6Kb
UniProtKB ID: Q9UBS0, B2RMZ9, O94809, Q9UEC1
Gene ID:
Human(6199) Summary: This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 nonidentical kinase catalytic domains and phosphorylates the S6 ribosomal protein and eucaryotic translation initiation factor 4B (eIF4B). Phosphorylation of S6 leads to an increase in protein synthesis and cell proliferation. [provided by RefSeq, Jul 2008]
Mouse(58988) ribosomal protein S6 kinase, polypeptide 2
Rat(361696) ribosomal protein S6 kinase, polypeptide 2
domestic cat(101091812) ribosomal protein S6 kinase, 70kDa, polypeptide 2
dog(610499) ribosomal protein S6 kinase, 70kDa, polypeptide 2
naked mole-rat(101702911) ribosomal protein S6 kinase, 70kDa, polypeptide 2
domestic guinea pig(100722430) ribosomal protein S6 kinase, 70kDa, polypeptide 2
cow(506083) ribosomal protein S6 kinase, 70kDa, polypeptide 2
sheep(101109574) ribosomal protein S6 kinase, 70kDa, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007071 Rosetta Predictions human pricing
NM_003952 Rosetta Predictions human pricing
NM_001010962 Rosetta Predictions rat pricing
NM_021485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218651 predicted 1130
2 SASI_Hs01_00218652 predicted 440
3 SASI_Hs01_00218653 predicted 1115
4 SASI_Hs01_00218654 predicted 421
5 SASI_Hs01_00218655 predicted 372
6 SASI_Hs01_00218656 predicted 1165
7 SASI_Hs01_00218657 predicted 1123
8 SASI_Hs01_00218658 predicted 536
9 SASI_Hs01_00218659 predicted 405
10 SASI_Hs01_00218660 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336617 predicted 1029
2 SASI_Hs02_00336618 predicted 483
3 SASI_Hs01_00096114 predicted 1149
4 SASI_Hs01_00096115 predicted 433
5 SASI_Hs01_00096116 predicted 1132
6 SASI_Hs02_00336619 predicted 809
7 SASI_Hs01_00096117 predicted 419
8 SASI_Hs02_00336620 predicted 517
9 SASI_Hs01_00096118 predicted 362
10 SASI_Hs02_00336621 predicted 631
11 SASI_Hs01_00096119 predicted 1186
12 SASI_Hs01_00096120 predicted 1145
13 SASI_Hs01_00096121 predicted 530
14 SASI_Hs01_00096122 predicted 411
15 SASI_Hs01_00096123 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080616 predicted 1133
2 SASI_Rn01_00080617 predicted 723
3 SASI_Rn02_00199833 predicted 800
4 SASI_Rn01_00080618 predicted 684
5 SASI_Rn01_00080619 predicted 423
6 SASI_Rn02_00199834 predicted 1237
7 SASI_Rn01_00080620 predicted 731
8 SASI_Rn02_00199835 predicted 1167
9 SASI_Rn01_00080622 predicted 600
10 SASI_Rn01_00080623 predicted 783
11 SASI_Rn01_00080621 predicted 244
12 SASI_Rn01_00080624 predicted 523
13 SASI_Rn01_00080625 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175565 predicted 284
2 SASI_Mm01_00175566 predicted 350
3 SASI_Mm01_00175568 predicted 407
4 SASI_Mm02_00326175 predicted 1170
5 SASI_Mm02_00326176 predicted 319
6 SASI_Mm01_00175569 predicted 332
7 SASI_Mm01_00175571 predicted 450
8 SASI_Mm01_00175572 predicted 1057
9 SASI_Mm01_00175573 predicted 665
10 SASI_Mm01_00175574 predicted 372
11 SASI_Mm01_00175567 predicted 660
12 SASI_Mm01_00175570 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003952
VALIDATED
RPS6KB2 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 70kDa, polypeptide 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-702s21c1
Sequence:CCGGACATCAAACTGACCGACTTTGCTCGAGCAAAGTCGGTCAGTTTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-1141s21c1
Sequence:CCGGGGACGTGAGCCAGTTTGATACCTCGAGGTATCAAACTGGCTCACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-438s21c1
Sequence:CCGGAGCGGAACATTCTAGAGTCAGCTCGAGCTGACTCTAGAATGTTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.2-371s1c1
Sequence:CCGGGCCATGAAAGTCCTAAGGAAGCTCGAGCTTCCTTAGGACTTTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.2-1182s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-859s21c1
Sequence:CCGGGTACGACATGCTCACTGGATCCTCGAGGATCCAGTGAGCATGTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-727s21c1
Sequence:CCGGCTGCAAGGAGTCTATCCATGACTCGAGTCATGGATAGACTCCTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.2-1149s1c1
Sequence:CCGGGCCAGTTTGATACCCGCTTCACTCGAGTGAAGCGGGTATCAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003952.x-1618s1c1
Sequence:CCGGTGCGTATGAAAGTGTGTGTCTCTCGAGAGACACACACTTTCATACGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.x-1042s1c1
Sequence:CCGGCACATGAATTGGGACGACCTTCTCGAGAAGGTCGTCCCAATTCATGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-890s21c1
Sequence:CCGGACCGCAGAGAACCGGAAGAAACTCGAGTTTCTTCCGGTTCTCTGCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-440s1c1
Sequence:CCGGCCTTTATTGTGGAACTGGCCTCTCGAGAGGCCAGTTCCACAATAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-1112s1c1
Sequence:CCGGAGGACGTGAGCCAGTTTGATACTCGAGTATCAAACTGGCTCACGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-441s1c1
Sequence:CCGGCTTTATTGTGGAACTGGCCTACTCGAGTAGGCCAGTTCCACAATAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003952
VALIDATED
RPS6KB2 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 70kDa, polypeptide 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-702s21c1
Sequence:CCGGACATCAAACTGACCGACTTTGCTCGAGCAAAGTCGGTCAGTTTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-1141s21c1
Sequence:CCGGGGACGTGAGCCAGTTTGATACCTCGAGGTATCAAACTGGCTCACGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-438s21c1
Sequence:CCGGAGCGGAACATTCTAGAGTCAGCTCGAGCTGACTCTAGAATGTTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.2-371s1c1
Sequence:CCGGGCCATGAAAGTCCTAAGGAAGCTCGAGCTTCCTTAGGACTTTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.2-1182s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-859s21c1
Sequence:CCGGGTACGACATGCTCACTGGATCCTCGAGGATCCAGTGAGCATGTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-727s21c1
Sequence:CCGGCTGCAAGGAGTCTATCCATGACTCGAGTCATGGATAGACTCCTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.2-1149s1c1
Sequence:CCGGGCCAGTTTGATACCCGCTTCACTCGAGTGAAGCGGGTATCAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003952.x-1618s1c1
Sequence:CCGGTGCGTATGAAAGTGTGTGTCTCTCGAGAGACACACACTTTCATACGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.x-1042s1c1
Sequence:CCGGCACATGAATTGGGACGACCTTCTCGAGAAGGTCGTCCCAATTCATGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-890s21c1
Sequence:CCGGACCGCAGAGAACCGGAAGAAACTCGAGTTTCTTCCGGTTCTCTGCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-440s1c1
Sequence:CCGGCCTTTATTGTGGAACTGGCCTCTCGAGAGGCCAGTTCCACAATAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-1112s1c1
Sequence:CCGGAGGACGTGAGCCAGTTTGATACTCGAGTATCAAACTGGCTCACGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-441s1c1
Sequence:CCGGCTTTATTGTGGAACTGGCCTACTCGAGTAGGCCAGTTCCACAATAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003952
VALIDATED
RPS6KB2 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 70kDa, polypeptide 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-702s21c1
Sequence:CCGGACATCAAACTGACCGACTTTGCTCGAGCAAAGTCGGTCAGTTTGATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-1141s21c1
Sequence:CCGGGGACGTGAGCCAGTTTGATACCTCGAGGTATCAAACTGGCTCACGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-438s21c1
Sequence:CCGGAGCGGAACATTCTAGAGTCAGCTCGAGCTGACTCTAGAATGTTCCGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.2-371s1c1
Sequence:CCGGGCCATGAAAGTCCTAAGGAAGCTCGAGCTTCCTTAGGACTTTCATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.2-1182s1c1
Sequence:UNK
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-859s21c1
Sequence:CCGGGTACGACATGCTCACTGGATCCTCGAGGATCCAGTGAGCATGTCGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-727s21c1
Sequence:CCGGCTGCAAGGAGTCTATCCATGACTCGAGTCATGGATAGACTCCTTGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.2-1149s1c1
Sequence:CCGGGCCAGTTTGATACCCGCTTCACTCGAGTGAAGCGGGTATCAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003952.x-1618s1c1
Sequence:CCGGTGCGTATGAAAGTGTGTGTCTCTCGAGAGACACACACTTTCATACGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003952.x-1042s1c1
Sequence:CCGGCACATGAATTGGGACGACCTTCTCGAGAAGGTCGTCCCAATTCATGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003952.2-890s21c1
Sequence:CCGGACCGCAGAGAACCGGAAGAAACTCGAGTTTCTTCCGGTTCTCTGCGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-440s1c1
Sequence:CCGGCCTTTATTGTGGAACTGGCCTCTCGAGAGGCCAGTTCCACAATAAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-1112s1c1
Sequence:CCGGAGGACGTGAGCCAGTTTGATACTCGAGTATCAAACTGGCTCACGTCCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003952.x-441s1c1
Sequence:CCGGCTTTATTGTGGAACTGGCCTACTCGAGTAGGCCAGTTCCACAATAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021485
RPS6KB2 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 70kDa, polypeptide 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-641s21c1
Sequence:CCGGGACTTTGCAAGGAGTCCATTCCTCGAGGAATGGACTCCTTGCAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-284s21c1
Sequence:CCGGTATATGCCATGAAGGTCTTAACTCGAGTTAAGACCTTCATGGCATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-1272s1c1
Sequence:CCGGCCTCAAGTTCTCTCCCTTTGACTCGAGTCAAAGGGAGAGAACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-312s1c1
Sequence:CCGGCAAGATTGTATGCAGTGCCAACTCGAGTTGGCACTGCATACAATCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-116s21c1
Sequence:CCGGTGGAGACAGTGGGACACTATGCTCGAGCATAGTGTCCCACTGTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-1147s21c1
Sequence:CCGGGCCTTCCTGGGCTTTACATATCTCGAGATATGTAAAGCCCAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-82s1c1
Sequence:CCGGGTGTGTCCTCTTGGCGAATTACTCGAGTAATTCGCCAAGAGGACACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-1100s1c1
Sequence:CCGGCGGTAGATAGTCCAGATGACACTCGAGTGTCATCTGGACTATCTACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021485
RPS6KB2 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 70kDa, polypeptide 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-641s21c1
Sequence:CCGGGACTTTGCAAGGAGTCCATTCCTCGAGGAATGGACTCCTTGCAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-284s21c1
Sequence:CCGGTATATGCCATGAAGGTCTTAACTCGAGTTAAGACCTTCATGGCATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-1272s1c1
Sequence:CCGGCCTCAAGTTCTCTCCCTTTGACTCGAGTCAAAGGGAGAGAACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-312s1c1
Sequence:CCGGCAAGATTGTATGCAGTGCCAACTCGAGTTGGCACTGCATACAATCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-116s21c1
Sequence:CCGGTGGAGACAGTGGGACACTATGCTCGAGCATAGTGTCCCACTGTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-1147s21c1
Sequence:CCGGGCCTTCCTGGGCTTTACATATCTCGAGATATGTAAAGCCCAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-82s1c1
Sequence:CCGGGTGTGTCCTCTTGGCGAATTACTCGAGTAATTCGCCAAGAGGACACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-1100s1c1
Sequence:CCGGCGGTAGATAGTCCAGATGACACTCGAGTGTCATCTGGACTATCTACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021485
RPS6KB2 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 70kDa, polypeptide 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-641s21c1
Sequence:CCGGGACTTTGCAAGGAGTCCATTCCTCGAGGAATGGACTCCTTGCAAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-284s21c1
Sequence:CCGGTATATGCCATGAAGGTCTTAACTCGAGTTAAGACCTTCATGGCATATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-1272s1c1
Sequence:CCGGCCTCAAGTTCTCTCCCTTTGACTCGAGTCAAAGGGAGAGAACTTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-312s1c1
Sequence:CCGGCAAGATTGTATGCAGTGCCAACTCGAGTTGGCACTGCATACAATCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-116s21c1
Sequence:CCGGTGGAGACAGTGGGACACTATGCTCGAGCATAGTGTCCCACTGTCTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021485.2-1147s21c1
Sequence:CCGGGCCTTCCTGGGCTTTACATATCTCGAGATATGTAAAGCCCAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-82s1c1
Sequence:CCGGGTGTGTCCTCTTGGCGAATTACTCGAGTAATTCGCCAAGAGGACACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021485.1-1100s1c1
Sequence:CCGGCGGTAGATAGTCCAGATGACACTCGAGTGTCATCTGGACTATCTACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)