EMAIL THIS PAGE TO A FRIEND

RPSA

ribosomal protein SA

72 Gene Product Result for
Synonyms: 37LRP 67LR LAMBR LAMR1 LBP LBP/p40 LRP LRP/LR NEM/1CHD4 SA lamR p40
Gene ID:
Human(3921) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16785) ribosomal protein SA
Rat(29236) ribosomal protein SA
Zebrafish(394027) ribosomal protein SA
chicken(395181) ribosomal protein SA
Horse(100055367) ribosomal protein SA
domestic cat(101098981) ribosomal protein SA
dog(477029) ribosomal protein SA
Domestic Rabbit(100144340) ribosomal protein SA
naked mole-rat(101697519) ribosomal protein SA
domestic guinea pig(100730948) ribosomal protein SA
cow(281898) ribosomal protein SA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012321 Rosetta Predictions human pricing
NM_017138 Rosetta Predictions rat pricing
NM_011029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050795 predicted 622
2 SASI_Hs01_00050796 predicted 631
3 SASI_Hs01_00050797 predicted 683
4 SASI_Hs01_00050798 predicted 682
5 SASI_Hs01_00050799 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031686 predicted 235
2 SASI_Rn01_00031687 predicted 251
3 SASI_Rn01_00031688 predicted 231
4 SASI_Rn01_00031689 predicted 558
5 SASI_Rn02_00261384 predicted 273
6 SASI_Rn02_00261385 predicted 419
7 SASI_Rn01_00031692 predicted 560
8 SASI_Rn02_00261386 predicted 640
9 SASI_Rn01_00031695 predicted 354
10 SASI_Rn02_00261387 predicted 727
11 SASI_Rn01_00031690 predicted 495
12 SASI_Rn01_00031691 predicted 218
13 SASI_Rn01_00031693 predicted 250
14 SASI_Rn01_00031694 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068243 predicted 1388
2 SASI_Mm01_00068244 predicted 1450
3 SASI_Mm01_00068245 predicted 1418
4 SASI_Mm01_00068246 predicted 1416
5 SASI_Mm01_00068247 predicted 1408
6 SASI_Mm01_00068248 predicted 1374
7 SASI_Mm02_00319763 predicted 357
8 SASI_Mm02_00319764 predicted 333
9 SASI_Mm01_00068249 predicted 1099
10 SASI_Mm01_00068250 predicted 1174
11 SASI_Mm01_00068251 predicted 1209
12 SASI_Mm01_00068252 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002295
RPSA MISSION shRNA Bacterial Glycerol Stock
ribosomal protein SA
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-181s21c1
Sequence:CCGGCCAGATGGAACAGTACATCTACTCGAGTAGATGTACTGTTCCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-296s21c1
Sequence:CCGGCCTGCTGATGTCAGTGTTATACTCGAGTATAACACTGACATCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-683s21c1
Sequence:CCGGGATCTGTACTTCTACAGAGATCTCGAGATCTCTGTAGAAGTACAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-272s1c1
Sequence:CCGGCGTGCAATTGTTGCCATTGAACTCGAGTTCAATGGCAACAATTGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-746s21c1
Sequence:CCGGGCAGTGACCAAGGAGGAATTTCTCGAGAAATTCCTCCTTGGTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-746s1c1
Sequence:CCGGGCAGTGACCAAGGAGGAATTTCTCGAGAAATTCCTCCTTGGTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-181s1c1
Sequence:CCGGCCAGATGGAACAGTACATCTACTCGAGTAGATGTACTGTTCCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-296s1c1
Sequence:CCGGCCTGCTGATGTCAGTGTTATACTCGAGTATAACACTGACATCAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-683s1c1
Sequence:CCGGGATCTGTACTTCTACAGAGATCTCGAGATCTCTGTAGAAGTACAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002295
RPSA MISSION shRNA shRNA Plasmid DNA
ribosomal protein SA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-181s21c1
Sequence:CCGGCCAGATGGAACAGTACATCTACTCGAGTAGATGTACTGTTCCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-296s21c1
Sequence:CCGGCCTGCTGATGTCAGTGTTATACTCGAGTATAACACTGACATCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-683s21c1
Sequence:CCGGGATCTGTACTTCTACAGAGATCTCGAGATCTCTGTAGAAGTACAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-272s1c1
Sequence:CCGGCGTGCAATTGTTGCCATTGAACTCGAGTTCAATGGCAACAATTGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-746s21c1
Sequence:CCGGGCAGTGACCAAGGAGGAATTTCTCGAGAAATTCCTCCTTGGTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-746s1c1
Sequence:CCGGGCAGTGACCAAGGAGGAATTTCTCGAGAAATTCCTCCTTGGTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-181s1c1
Sequence:CCGGCCAGATGGAACAGTACATCTACTCGAGTAGATGTACTGTTCCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-296s1c1
Sequence:CCGGCCTGCTGATGTCAGTGTTATACTCGAGTATAACACTGACATCAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-683s1c1
Sequence:CCGGGATCTGTACTTCTACAGAGATCTCGAGATCTCTGTAGAAGTACAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002295
RPSA MISSION shRNA Lentiviral Transduction Particles
ribosomal protein SA
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-181s21c1
Sequence:CCGGCCAGATGGAACAGTACATCTACTCGAGTAGATGTACTGTTCCATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-296s21c1
Sequence:CCGGCCTGCTGATGTCAGTGTTATACTCGAGTATAACACTGACATCAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-683s21c1
Sequence:CCGGGATCTGTACTTCTACAGAGATCTCGAGATCTCTGTAGAAGTACAGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-272s1c1
Sequence:CCGGCGTGCAATTGTTGCCATTGAACTCGAGTTCAATGGCAACAATTGCACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002295.4-746s21c1
Sequence:CCGGGCAGTGACCAAGGAGGAATTTCTCGAGAAATTCCTCCTTGGTCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-746s1c1
Sequence:CCGGGCAGTGACCAAGGAGGAATTTCTCGAGAAATTCCTCCTTGGTCACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-181s1c1
Sequence:CCGGCCAGATGGAACAGTACATCTACTCGAGTAGATGTACTGTTCCATCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-296s1c1
Sequence:CCGGCCTGCTGATGTCAGTGTTATACTCGAGTATAACACTGACATCAGCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002295.2-683s1c1
Sequence:CCGGGATCTGTACTTCTACAGAGATCTCGAGATCTCTGTAGAAGTACAGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011029
RPSA MISSION shRNA Bacterial Glycerol Stock
ribosomal protein SA
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000104470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011029.2-1347s1c1
Sequence:CCGGCCAGGAACAAAGTTAATGCTACTCGAGTAGCATTAACTTTGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-672s1c1
Sequence:CCGGCCTGATCTTTACTTCTACAGACTCGAGTCTGTAGAAGTAAAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-204s1c1
Sequence:CCGGAGTGACGGTATCTACATCATACTCGAGTATGATGTAGATACCGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-206s1c1
Sequence:CCGGTGACGGTATCTACATCATAAACTCGAGTTTATGATGTAGATACCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011029
RPSA MISSION shRNA shRNA Plasmid DNA
ribosomal protein SA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000104470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011029.2-1347s1c1
Sequence:CCGGCCAGGAACAAAGTTAATGCTACTCGAGTAGCATTAACTTTGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-672s1c1
Sequence:CCGGCCTGATCTTTACTTCTACAGACTCGAGTCTGTAGAAGTAAAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-204s1c1
Sequence:CCGGAGTGACGGTATCTACATCATACTCGAGTATGATGTAGATACCGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-206s1c1
Sequence:CCGGTGACGGTATCTACATCATAAACTCGAGTTTATGATGTAGATACCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011029
RPSA MISSION shRNA Lentiviral Transduction Particles
ribosomal protein SA
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000104470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011029.2-1347s1c1
Sequence:CCGGCCAGGAACAAAGTTAATGCTACTCGAGTAGCATTAACTTTGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-672s1c1
Sequence:CCGGCCTGATCTTTACTTCTACAGACTCGAGTCTGTAGAAGTAAAGATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-204s1c1
Sequence:CCGGAGTGACGGTATCTACATCATACTCGAGTATGATGTAGATACCGTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011029.2-206s1c1
Sequence:CCGGTGACGGTATCTACATCATAAACTCGAGTTTATGATGTAGATACCGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)