EMAIL THIS PAGE TO A FRIEND

RPTOR

regulatory associated protein of MTOR, complex 1

60 Gene Product Result for
Synonyms: KOG1 Mip1
UniProtKB ID: Q8N122, B2RN36, Q8N4V9, Q8TB32, Q9P2P3
Gene ID:
Human(57521) Summary: This gene encodes a component of a signaling pathway that regulates cell growth in response to nutrient and insulin levels. The encoded protein forms a stoichiometric complex with the mTOR kinase, and also associates with eukaryotic initiation factor 4E-binding protein-1 and ribosomal protein S6 kinase. The protein positively regulates the downstream effector ribosomal protein S6 kinase, and negatively regulates the mTOR kinase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(74370) regulatory associated protein of MTOR, complex 1
Rat(287871) regulatory associated protein of MTOR, complex 1
naked mole-rat(101724257) regulatory associated protein of MTOR, complex 1
domestic guinea pig(100729707) regulatory associated protein of MTOR, complex 1
cow(507056) regulatory associated protein of MTOR, complex 1
sheep(101119321) regulatory associated protein of MTOR, complex 1
Zebrafish(560455) regulatory associated protein of MTOR, complex 1
chicken(428674) regulatory associated protein of MTOR, complex 1
dog(608378) regulatory associated protein of MTOR, complex 1
domestic cat(101086862) regulatory associated protein of MTOR, complex 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305088 ANTI-PHOSPHO-RAPTOR(S863) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1300723 Anti-Phospho-Raptor-S863 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA pricing
PRS3489 Anti-Raptor (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
ELISA, immunocytochemistry, western blot pricing
PRS3491 Anti-Raptor (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
PRS3493 Anti-Raptor (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB1400656 Anti-RPTOR antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA029821 Anti-RPTOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA064306 Anti-RPTOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1403328 Monoclonal Anti-RPTOR, (C-terminal) antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020761 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058101 MISSION® esiRNA esiRNA targeting mouse 4932417H02Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020761 Rosetta Predictions human pricing
NM_001134499 Rosetta Predictions rat pricing
NM_028898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048380 predicted 1829
2 SASI_Hs01_00048381 predicted 3206
3 SASI_Hs01_00048382 predicted 4624
4 SASI_Hs01_00048383 predicted 1319
5 SASI_Hs01_00048384 predicted 4318
6 SASI_Hs01_00048386 predicted 1394
7 SASI_Hs01_00048387 predicted 2999
8 SASI_Hs01_00048388 predicted 1469
9 SASI_Hs01_00048389 predicted 3807
10 SASI_Hs02_00353883 predicted 3393
11 SASI_Hs01_00048385 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256479 predicted 270
2 SASI_Rn02_00256480 predicted 2803
3 SASI_Rn02_00256481 predicted 898
4 SASI_Rn02_00256482 predicted 258
5 SASI_Rn02_00256483 predicted 2845
6 SASI_Rn02_00256484 predicted 644
7 SASI_Rn02_00256485 predicted 2621
8 SASI_Rn02_00256486 predicted 1938
9 SASI_Rn02_00256487 predicted 1100
10 SASI_Rn02_00256488 predicted 3073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055293 predicted 1837
2 SASI_Mm02_00334580 predicted 4551
3 SASI_Mm01_00055295 predicted 1076
4 SASI_Mm01_00055296 predicted 1874
5 SASI_Mm01_00055297 predicted 1332
6 SASI_Mm01_00055298 predicted 3613
7 SASI_Mm02_00334581 predicted 3285
8 SASI_Mm01_00055299 predicted 3634
9 SASI_Mm02_00334582 predicted 3699
10 SASI_Mm01_00055301 predicted 3408
11 SASI_Mm01_00055294 predicted 2470
12 SASI_Mm01_00055300 predicted 2897
13 SASI_Mm01_00055302 predicted 3088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020761
VALIDATED
RPTOR MISSION shRNA Bacterial Glycerol Stock
regulatory associated protein of MTOR, complex 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.x-4703s1c1
Sequence:CCGGCATGTAATCAGAGCATTAGCTCTCGAGAGCTAATGCTCTGATTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.x-1895s1c1
Sequence:CCGGGACAACGGCCACAAGTACTTCTCGAGAAGTACTTGTGGCCGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-4768s21c1
Sequence:CCGGCGACTACTACATCTCCGTGTACTCGAGTACACGGAGATGTAGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-4689s1c1
Sequence:CCGGCCTCACTTTATTTCCATGTAACTCGAGTTACATGGAAATAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-1422s1c1
Sequence:CCGGGAAAGGATTATGAGGTCGTATCTCGAGATACGACCTCATAATCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-795s1c1
Sequence:CCGGCGAGTCCTCTTTCACTACAATCTCGAGATTGTAGTGAAAGAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-2564s1c1
Sequence:CCGGCCTCAACAAATCTTTGCAGAACTCGAGTTCTGCAAAGATTTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-4325s1c1
Sequence:CCGGCGACTACTACATCTCCGTGTACTCGAGTACACGGAGATGTAGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-854s21c1
Sequence:CCGGGATGAGGCTGATCTTACAGACCTCGAGGTCTGTAAGATCAGCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-1238s21c1
Sequence:CCGGCGAGTCCTCTTTCACTACAATCTCGAGATTGTAGTGAAAGAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-2338s21c1
Sequence:CCGGGGACAACGGCCACAAGTACTTCTCGAGAAGTACTTGTGGCCGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020761
VALIDATED
RPTOR MISSION shRNA shRNA Plasmid DNA
regulatory associated protein of MTOR, complex 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.x-4703s1c1
Sequence:CCGGCATGTAATCAGAGCATTAGCTCTCGAGAGCTAATGCTCTGATTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.x-1895s1c1
Sequence:CCGGGACAACGGCCACAAGTACTTCTCGAGAAGTACTTGTGGCCGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-4768s21c1
Sequence:CCGGCGACTACTACATCTCCGTGTACTCGAGTACACGGAGATGTAGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-4689s1c1
Sequence:CCGGCCTCACTTTATTTCCATGTAACTCGAGTTACATGGAAATAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-1422s1c1
Sequence:CCGGGAAAGGATTATGAGGTCGTATCTCGAGATACGACCTCATAATCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-795s1c1
Sequence:CCGGCGAGTCCTCTTTCACTACAATCTCGAGATTGTAGTGAAAGAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-2564s1c1
Sequence:CCGGCCTCAACAAATCTTTGCAGAACTCGAGTTCTGCAAAGATTTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-4325s1c1
Sequence:CCGGCGACTACTACATCTCCGTGTACTCGAGTACACGGAGATGTAGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-854s21c1
Sequence:CCGGGATGAGGCTGATCTTACAGACCTCGAGGTCTGTAAGATCAGCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-1238s21c1
Sequence:CCGGCGAGTCCTCTTTCACTACAATCTCGAGATTGTAGTGAAAGAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-2338s21c1
Sequence:CCGGGGACAACGGCCACAAGTACTTCTCGAGAAGTACTTGTGGCCGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020761
VALIDATED
RPTOR MISSION shRNA Lentiviral Transduction Particles
regulatory associated protein of MTOR, complex 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.x-4703s1c1
Sequence:CCGGCATGTAATCAGAGCATTAGCTCTCGAGAGCTAATGCTCTGATTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.x-1895s1c1
Sequence:CCGGGACAACGGCCACAAGTACTTCTCGAGAAGTACTTGTGGCCGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-4768s21c1
Sequence:CCGGCGACTACTACATCTCCGTGTACTCGAGTACACGGAGATGTAGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-4689s1c1
Sequence:CCGGCCTCACTTTATTTCCATGTAACTCGAGTTACATGGAAATAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-1422s1c1
Sequence:CCGGGAAAGGATTATGAGGTCGTATCTCGAGATACGACCTCATAATCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-795s1c1
Sequence:CCGGCGAGTCCTCTTTCACTACAATCTCGAGATTGTAGTGAAAGAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-2564s1c1
Sequence:CCGGCCTCAACAAATCTTTGCAGAACTCGAGTTCTGCAAAGATTTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020761.1-4325s1c1
Sequence:CCGGCGACTACTACATCTCCGTGTACTCGAGTACACGGAGATGTAGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-854s21c1
Sequence:CCGGGATGAGGCTGATCTTACAGACCTCGAGGTCTGTAAGATCAGCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-1238s21c1
Sequence:CCGGCGAGTCCTCTTTCACTACAATCTCGAGATTGTAGTGAAAGAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020761.2-2338s21c1
Sequence:CCGGGGACAACGGCCACAAGTACTTCTCGAGAAGTACTTGTGGCCGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028898
VALIDATED
RPTOR MISSION shRNA Bacterial Glycerol Stock
regulatory associated protein of MTOR, complex 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028898.1-658s1c1
Sequence:CCGGGCTGCGATTAACCCAAACCATCTCGAGATGGTTTGGGTTAATCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-3729s1c1
Sequence:CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-1026s1c1
Sequence:CCGGCGTGGCAAGTTTGTTTAGAAACTCGAGTTTCTAAACAAACTTGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028898.1-600s1c1
Sequence:CCGGCCTCATCGTCAAGTCCTTCAACTCGAGTTGAAGGACTTGACGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-2465s1c1
Sequence:CCGGCCTATCCAGATGTTTCTGATTCTCGAGAATCAGAAACATCTGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028898
VALIDATED
RPTOR MISSION shRNA shRNA Plasmid DNA
regulatory associated protein of MTOR, complex 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028898.1-658s1c1
Sequence:CCGGGCTGCGATTAACCCAAACCATCTCGAGATGGTTTGGGTTAATCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-3729s1c1
Sequence:CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-1026s1c1
Sequence:CCGGCGTGGCAAGTTTGTTTAGAAACTCGAGTTTCTAAACAAACTTGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028898.1-600s1c1
Sequence:CCGGCCTCATCGTCAAGTCCTTCAACTCGAGTTGAAGGACTTGACGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-2465s1c1
Sequence:CCGGCCTATCCAGATGTTTCTGATTCTCGAGAATCAGAAACATCTGGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028898
VALIDATED
RPTOR MISSION shRNA Lentiviral Transduction Particles
regulatory associated protein of MTOR, complex 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028898.1-658s1c1
Sequence:CCGGGCTGCGATTAACCCAAACCATCTCGAGATGGTTTGGGTTAATCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-3729s1c1
Sequence:CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-1026s1c1
Sequence:CCGGCGTGGCAAGTTTGTTTAGAAACTCGAGTTTCTAAACAAACTTGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028898.1-600s1c1
Sequence:CCGGCCTCATCGTCAAGTCCTTCAACTCGAGTTGAAGGACTTGACGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028898.1-2465s1c1
Sequence:CCGGCCTATCCAGATGTTTCTGATTCTCGAGAATCAGAAACATCTGGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)