EMAIL THIS PAGE TO A FRIEND

RRAGA

Ras-related GTP binding A

67 Gene Product Result for
Synonyms: FIP-1 FIP1 RAGA
UniProtKB ID: Q7L523, B2R7L1, O00290, Q15347
Gene ID:
Mouse(68441) Ras-related GTP binding A
Rat(117044) Ras-related GTP binding A
cow(618207) Ras-related GTP binding A
sheep(100302067) Ras-related GTP binding A
domestic guinea pig(100713018) Ras-related GTP binding A
naked mole-rat(101720836) Ras-related GTP binding A
Zebrafish(325358) Ras-related GTP binding A
dog(474719) Ras-related GTP binding A
domestic cat(101097430) Ras-related GTP binding A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006570 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051591 MISSION® esiRNA esiRNA human RRAGA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006570 Rosetta Predictions human pricing
NM_053973 Rosetta Predictions rat pricing
NM_178376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099501 predicted 371
2 SASI_Hs01_00099508 predicted 359
3 SASI_Hs02_00341852 predicted 357
4 SASI_Hs01_00099502 predicted 1234
5 SASI_Hs01_00099503 predicted 1411
6 SASI_Hs02_00341853 predicted 1066
7 SASI_Hs01_00099504 predicted 960
8 SASI_Hs01_00099505 predicted 1289
9 SASI_Hs01_00099506 predicted 1334
10 SASI_Hs01_00099507 predicted 1372
11 SASI_Hs01_00099509 predicted 914
12 SASI_Hs01_00099510 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119955 predicted 888
2 SASI_Rn01_00119956 predicted 841
3 SASI_Rn01_00119957 predicted 920
4 SASI_Rn01_00119958 predicted 528
5 SASI_Rn01_00119959 predicted 811
6 SASI_Rn01_00119960 predicted 926
7 SASI_Rn02_00266959 predicted 404
8 SASI_Rn01_00119961 predicted 809
9 SASI_Rn01_00119962 predicted 887
10 SASI_Rn01_00119964 predicted 970
11 SASI_Rn01_00119963 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155369 predicted 900
2 SASI_Mm01_00155370 predicted 854
3 SASI_Mm01_00155371 predicted 937
4 SASI_Mm01_00155372 predicted 924
5 SASI_Mm01_00155373 predicted 897
6 SASI_Mm01_00155374 predicted 817
7 SASI_Mm01_00155375 predicted 479
8 SASI_Mm01_00155376 predicted 561
9 SASI_Mm01_00155377 predicted 492
10 SASI_Mm01_00155378 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178376
VALIDATED
RRAGA MISSION shRNA Bacterial Glycerol Stock
Ras-related GTP binding A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-941s21c1
Sequence:CCGGGCAACATCATCAAGCAGTTTACTCGAGTAAACTGCTTGATGATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1158s21c1
Sequence:CCGGAGCCTCCTCATGCGTTGAAATCTCGAGATTTCAACGCATGAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1089s21c1
Sequence:CCGGACTCTGATCAACATTCGTAATCTCGAGATTACGAATGTTGATCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-489s21c1
Sequence:CCGGGAGGTTCTGATATACGTGTTTCTCGAGAAACACGTATATCAGAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-856s21c1
Sequence:CCGGGAGCTACGTTCTTGGTGATTTCTCGAGAAATCACCAAGAACGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-856s1c1
Sequence:CCGGGAGCTACGTTCTTGGTGATTTCTCGAGAAATCACCAAGAACGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-816s1c1
Sequence:CCGGGCCCAGATTATTGAGGCTGATCTCGAGATCAGCCTCAATAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-958s1c1
Sequence:CCGGGCAGTAAATTGGCCGCTTCTTCTCGAGAAGAAGCGGCCAATTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178376.2-1332s1c1
Sequence:CCGGCGCTATTTACTCAGCTATCAACTCGAGTTGATAGCTGAGTAAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-489s1c1
Sequence:CCGGGAGGTTCTGATATACGTGTTTCTCGAGAAACACGTATATCAGAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1447s21c1
Sequence:CCGGTTCTGGTTACCTGGTTATAATCTCGAGATTATAACCAGGTAACCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-1330s21c1
Sequence:CCGGCTTAGTATTGGACGCTATTTACTCGAGTAAATAGCGTCCAATACTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-1181s21c1
Sequence:CCGGTGCGTTGAAATAATGCCAAATCTCGAGATTTGGCATTATTTCAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178376
VALIDATED
RRAGA MISSION shRNA shRNA Plasmid DNA
Ras-related GTP binding A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-941s21c1
Sequence:CCGGGCAACATCATCAAGCAGTTTACTCGAGTAAACTGCTTGATGATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1158s21c1
Sequence:CCGGAGCCTCCTCATGCGTTGAAATCTCGAGATTTCAACGCATGAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1089s21c1
Sequence:CCGGACTCTGATCAACATTCGTAATCTCGAGATTACGAATGTTGATCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-489s21c1
Sequence:CCGGGAGGTTCTGATATACGTGTTTCTCGAGAAACACGTATATCAGAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-856s21c1
Sequence:CCGGGAGCTACGTTCTTGGTGATTTCTCGAGAAATCACCAAGAACGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-856s1c1
Sequence:CCGGGAGCTACGTTCTTGGTGATTTCTCGAGAAATCACCAAGAACGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-816s1c1
Sequence:CCGGGCCCAGATTATTGAGGCTGATCTCGAGATCAGCCTCAATAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-958s1c1
Sequence:CCGGGCAGTAAATTGGCCGCTTCTTCTCGAGAAGAAGCGGCCAATTTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178376.2-1332s1c1
Sequence:CCGGCGCTATTTACTCAGCTATCAACTCGAGTTGATAGCTGAGTAAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-489s1c1
Sequence:CCGGGAGGTTCTGATATACGTGTTTCTCGAGAAACACGTATATCAGAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1447s21c1
Sequence:CCGGTTCTGGTTACCTGGTTATAATCTCGAGATTATAACCAGGTAACCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-1330s21c1
Sequence:CCGGCTTAGTATTGGACGCTATTTACTCGAGTAAATAGCGTCCAATACTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-1181s21c1
Sequence:CCGGTGCGTTGAAATAATGCCAAATCTCGAGATTTGGCATTATTTCAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178376
VALIDATED
RRAGA MISSION shRNA Lentiviral Transduction Particles
Ras-related GTP binding A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-941s21c1
Sequence:CCGGGCAACATCATCAAGCAGTTTACTCGAGTAAACTGCTTGATGATGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1158s21c1
Sequence:CCGGAGCCTCCTCATGCGTTGAAATCTCGAGATTTCAACGCATGAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1089s21c1
Sequence:CCGGACTCTGATCAACATTCGTAATCTCGAGATTACGAATGTTGATCAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-489s21c1
Sequence:CCGGGAGGTTCTGATATACGTGTTTCTCGAGAAACACGTATATCAGAACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-856s21c1
Sequence:CCGGGAGCTACGTTCTTGGTGATTTCTCGAGAAATCACCAAGAACGTAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-856s1c1
Sequence:CCGGGAGCTACGTTCTTGGTGATTTCTCGAGAAATCACCAAGAACGTAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-816s1c1
Sequence:CCGGGCCCAGATTATTGAGGCTGATCTCGAGATCAGCCTCAATAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-958s1c1
Sequence:CCGGGCAGTAAATTGGCCGCTTCTTCTCGAGAAGAAGCGGCCAATTTACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178376.2-1332s1c1
Sequence:CCGGCGCTATTTACTCAGCTATCAACTCGAGTTGATAGCTGAGTAAATAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178376.2-489s1c1
Sequence:CCGGGAGGTTCTGATATACGTGTTTCTCGAGAAACACGTATATCAGAACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.2-1447s21c1
Sequence:CCGGTTCTGGTTACCTGGTTATAATCTCGAGATTATAACCAGGTAACCAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-1330s21c1
Sequence:CCGGCTTAGTATTGGACGCTATTTACTCGAGTAAATAGCGTCCAATACTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178376.3-1181s21c1
Sequence:CCGGTGCGTTGAAATAATGCCAAATCTCGAGATTTGGCATTATTTCAACGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006570
RRAGA MISSION shRNA Bacterial Glycerol Stock
Ras-related GTP binding A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-1072s21c1
Sequence:CCGGCATCGACATCTTCACCTCAAACTCGAGTTTGAGGTGAAGATGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-358s21c1
Sequence:CCGGGTCGATAATCTTCGCCAATTACTCGAGTAATTGGCGAAGATTATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-964s21c1
Sequence:CCGGCCGGTTTGAGAAGATCAGCAACTCGAGTTGCTGATCTTCTCAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-487s1c1
Sequence:CCGGGCGAGACAATATCTTCCGTAACTCGAGTTACGGAAGATATTGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-934s1c1
Sequence:CCGGCCGGTTTGAGAAGATCAGCAACTCGAGTTGCTGATCTTCTCAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-1042s1c1
Sequence:CCGGCATCGACATCTTCACCTCAAACTCGAGTTTGAGGTGAAGATGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-868s1c1
Sequence:CCGGGCTGTTCGAAAGAGCTACATTCTCGAGAATGTAGCTCTTTCGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-328s1c1
Sequence:CCGGGTCGATAATCTTCGCCAATTACTCGAGTAATTGGCGAAGATTATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-517s21c1
Sequence:CCGGGCGAGACAATATCTTCCGTAACTCGAGTTACGGAAGATATTGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-898s21c1
Sequence:CCGGGCTGTTCGAAAGAGCTACATTCTCGAGAATGTAGCTCTTTCGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006570
RRAGA MISSION shRNA shRNA Plasmid DNA
Ras-related GTP binding A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-1072s21c1
Sequence:CCGGCATCGACATCTTCACCTCAAACTCGAGTTTGAGGTGAAGATGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-358s21c1
Sequence:CCGGGTCGATAATCTTCGCCAATTACTCGAGTAATTGGCGAAGATTATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-964s21c1
Sequence:CCGGCCGGTTTGAGAAGATCAGCAACTCGAGTTGCTGATCTTCTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-487s1c1
Sequence:CCGGGCGAGACAATATCTTCCGTAACTCGAGTTACGGAAGATATTGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-934s1c1
Sequence:CCGGCCGGTTTGAGAAGATCAGCAACTCGAGTTGCTGATCTTCTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-1042s1c1
Sequence:CCGGCATCGACATCTTCACCTCAAACTCGAGTTTGAGGTGAAGATGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-868s1c1
Sequence:CCGGGCTGTTCGAAAGAGCTACATTCTCGAGAATGTAGCTCTTTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-328s1c1
Sequence:CCGGGTCGATAATCTTCGCCAATTACTCGAGTAATTGGCGAAGATTATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-517s21c1
Sequence:CCGGGCGAGACAATATCTTCCGTAACTCGAGTTACGGAAGATATTGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-898s21c1
Sequence:CCGGGCTGTTCGAAAGAGCTACATTCTCGAGAATGTAGCTCTTTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006570
RRAGA MISSION shRNA Lentiviral Transduction Particles
Ras-related GTP binding A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-1072s21c1
Sequence:CCGGCATCGACATCTTCACCTCAAACTCGAGTTTGAGGTGAAGATGTCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-358s21c1
Sequence:CCGGGTCGATAATCTTCGCCAATTACTCGAGTAATTGGCGAAGATTATCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-964s21c1
Sequence:CCGGCCGGTTTGAGAAGATCAGCAACTCGAGTTGCTGATCTTCTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-487s1c1
Sequence:CCGGGCGAGACAATATCTTCCGTAACTCGAGTTACGGAAGATATTGTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-934s1c1
Sequence:CCGGCCGGTTTGAGAAGATCAGCAACTCGAGTTGCTGATCTTCTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-1042s1c1
Sequence:CCGGCATCGACATCTTCACCTCAAACTCGAGTTTGAGGTGAAGATGTCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-868s1c1
Sequence:CCGGGCTGTTCGAAAGAGCTACATTCTCGAGAATGTAGCTCTTTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006570.3-328s1c1
Sequence:CCGGGTCGATAATCTTCGCCAATTACTCGAGTAATTGGCGAAGATTATCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-517s21c1
Sequence:CCGGGCGAGACAATATCTTCCGTAACTCGAGTTACGGAAGATATTGTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006570.4-898s21c1
Sequence:CCGGGCTGTTCGAAAGAGCTACATTCTCGAGAATGTAGCTCTTTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)