EMAIL THIS PAGE TO A FRIEND

RRH

retinal pigment epithelium-derived rhodopsin homolog

52 Gene Product Result for
UniProtKB ID: O14718, A1A4V2, Q7RTS4
Gene ID:
Human(10692) Summary: Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes opsin 5 and retinal G protein coupled receptor. [provided by RefSeq, Jul 2008]
Mouse(20132) retinal pigment epithelium derived rhodopsin homolog
Rat(310869) retinal pigment epithelium derived rhodopsin homolog
Zebrafish(447916) retinal pigment epithelium-derived rhodopsin homolog
chicken(771805) retinal pigment epithelium-derived rhodopsin homolog
domestic cat(101083336) retinal pigment epithelium-derived rhodopsin homolog
dog(610525) retinal pigment epithelium-derived rhodopsin homolog
cow(539343) retinal pigment epithelium-derived rhodopsin homolog
sheep(101118787) retinal pigment epithelium-derived rhodopsin homolog
domestic guinea pig(100717822) retinal pigment epithelium-derived rhodopsin homolog
naked mole-rat(101705138) retinal pigment epithelium-derived rhodopsin homolog
Domestic Rabbit(100357763) retinal pigment epithelium-derived rhodopsin homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006583 Rosetta Predictions human pricing
NM_001107726 Rosetta Predictions rat pricing
XM_227718 Rosetta Predictions rat pricing
NM_009102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217516 predicted 1107
2 SASI_Hs01_00217517 predicted 599
3 SASI_Hs01_00217518 predicted 752
4 SASI_Hs02_00341876 predicted 1136
5 SASI_Hs01_00217520 predicted 903
6 SASI_Hs01_00217521 predicted 1302
7 SASI_Hs01_00217522 predicted 726
8 SASI_Hs01_00217523 predicted 1223
9 SASI_Hs01_00217525 predicted 1258
10 SASI_Hs02_00341877 predicted 662
11 SASI_Hs01_00217519 predicted 1330
12 SASI_Hs01_00217524 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231665 predicted 588
2 SASI_Rn02_00231666 predicted 374
3 SASI_Rn02_00231667 predicted 450
4 SASI_Rn02_00231668 predicted 556
5 SASI_Rn02_00231669 predicted 838
6 SASI_Rn02_00231670 predicted 757
7 SASI_Rn02_00231671 predicted 301
8 SASI_Rn02_00231672 predicted 287
9 SASI_Rn02_00231673 predicted 348
10 SASI_Rn02_00231674 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166996 predicted 400
2 SASI_Rn01_00166997 predicted 645
3 SASI_Rn01_00166998 predicted 669
4 SASI_Rn01_00166999 predicted 302
5 SASI_Rn01_00167000 predicted 582
6 SASI_Rn01_00167001 predicted 567
7 SASI_Rn01_00167002 predicted 345
8 SASI_Rn01_00167003 predicted 619
9 SASI_Rn01_00167004 predicted 283
10 SASI_Rn01_00167005 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047501 predicted 332
2 SASI_Mm01_00047503 predicted 422
3 SASI_Mm01_00047504 predicted 308
4 SASI_Mm01_00047505 predicted 414
5 SASI_Mm02_00315357 predicted 981
6 SASI_Mm01_00047506 predicted 893
7 SASI_Mm01_00047507 predicted 560
8 SASI_Mm02_00315358 predicted 1130
9 SASI_Mm01_00047508 predicted 997
10 SASI_Mm02_00315359 predicted 317
11 SASI_Mm01_00047500 predicted 740
12 SASI_Mm01_00047502 predicted 1045
13 SASI_Mm01_00047509 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006583
RRH MISSION shRNA Bacterial Glycerol Stock
retinal pigment epithelium-derived rhodopsin homolog
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-129s21c1
Sequence:CCGGTGATTATGGCAGGTATGATAACTCGAGTTATCATACCTGCCATAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-665s21c1
Sequence:CCGGCATGTCACGCTATCCATTAAACTCGAGTTTAATGGATAGCGTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-605s21c1
Sequence:CCGGATGACAGTTATTGCGATAAATCTCGAGATTTATCGCAATAACTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-206s21c1
Sequence:CCGGACACCCACAAATGCAATTATTCTCGAGAATAATTGCATTTGTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-673s1c1
Sequence:CCGGGCTATTACCATGTCACGCTATCTCGAGATAGCGTGACATGGTAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-922s1c1
Sequence:CCGGCCTGCATTTATGTGGTTGCTACTCGAGTAGCAACCACATAAATGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-619s1c1
Sequence:CCGGCCATGACAGTTATTGCGATAACTCGAGTTATCGCAATAACTGTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006583.1-1161s1c1
Sequence:CCGGCATTGTCCTATGAGAGTGTAACTCGAGTTACACTCTCATAGGACAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-813s1c1
Sequence:CCGGCCTTATTCCATCGTGTGCTTACTCGAGTAAGCACACGATGGAATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006583
RRH MISSION shRNA shRNA Plasmid DNA
retinal pigment epithelium-derived rhodopsin homolog
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-129s21c1
Sequence:CCGGTGATTATGGCAGGTATGATAACTCGAGTTATCATACCTGCCATAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-665s21c1
Sequence:CCGGCATGTCACGCTATCCATTAAACTCGAGTTTAATGGATAGCGTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-605s21c1
Sequence:CCGGATGACAGTTATTGCGATAAATCTCGAGATTTATCGCAATAACTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-206s21c1
Sequence:CCGGACACCCACAAATGCAATTATTCTCGAGAATAATTGCATTTGTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-673s1c1
Sequence:CCGGGCTATTACCATGTCACGCTATCTCGAGATAGCGTGACATGGTAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-922s1c1
Sequence:CCGGCCTGCATTTATGTGGTTGCTACTCGAGTAGCAACCACATAAATGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-619s1c1
Sequence:CCGGCCATGACAGTTATTGCGATAACTCGAGTTATCGCAATAACTGTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006583.1-1161s1c1
Sequence:CCGGCATTGTCCTATGAGAGTGTAACTCGAGTTACACTCTCATAGGACAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-813s1c1
Sequence:CCGGCCTTATTCCATCGTGTGCTTACTCGAGTAAGCACACGATGGAATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006583
RRH MISSION shRNA Lentiviral Transduction Particles
retinal pigment epithelium-derived rhodopsin homolog
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-129s21c1
Sequence:CCGGTGATTATGGCAGGTATGATAACTCGAGTTATCATACCTGCCATAATCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000363145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-665s21c1
Sequence:CCGGCATGTCACGCTATCCATTAAACTCGAGTTTAATGGATAGCGTGACATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-605s21c1
Sequence:CCGGATGACAGTTATTGCGATAAATCTCGAGATTTATCGCAATAACTGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006583.2-206s21c1
Sequence:CCGGACACCCACAAATGCAATTATTCTCGAGAATAATTGCATTTGTGGGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-673s1c1
Sequence:CCGGGCTATTACCATGTCACGCTATCTCGAGATAGCGTGACATGGTAATAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-922s1c1
Sequence:CCGGCCTGCATTTATGTGGTTGCTACTCGAGTAGCAACCACATAAATGCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-619s1c1
Sequence:CCGGCCATGACAGTTATTGCGATAACTCGAGTTATCGCAATAACTGTCATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006583.1-1161s1c1
Sequence:CCGGCATTGTCCTATGAGAGTGTAACTCGAGTTACACTCTCATAGGACAATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006583.1-813s1c1
Sequence:CCGGCCTTATTCCATCGTGTGCTTACTCGAGTAAGCACACGATGGAATAAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009102
RRH MISSION shRNA Bacterial Glycerol Stock
retinal pigment epithelium-derived rhodopsin homolog
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-713s1c1
Sequence:CCGGCCAGGCAGATGTAACAAAGATCTCGAGATCTTTGTTACATCTGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-773s1c1
Sequence:CCGGCCCTTATTCCATCGTGTGCTTCTCGAGAAGCACACGATGGAATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-149s1c1
Sequence:CCGGCCTGGGTATCTTCATCAAGTACTCGAGTACTTGATGAAGATACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-548s1c1
Sequence:CCGGGCGGAATAATGATACCTCGTTCTCGAGAACGAGGTATCATTATTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-315s1c1
Sequence:CCGGGCAGGACTGAATATCTTCTTTCTCGAGAAAGAAGATATTCAGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009102
RRH MISSION shRNA shRNA Plasmid DNA
retinal pigment epithelium-derived rhodopsin homolog
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-713s1c1
Sequence:CCGGCCAGGCAGATGTAACAAAGATCTCGAGATCTTTGTTACATCTGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-773s1c1
Sequence:CCGGCCCTTATTCCATCGTGTGCTTCTCGAGAAGCACACGATGGAATAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-149s1c1
Sequence:CCGGCCTGGGTATCTTCATCAAGTACTCGAGTACTTGATGAAGATACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-548s1c1
Sequence:CCGGGCGGAATAATGATACCTCGTTCTCGAGAACGAGGTATCATTATTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-315s1c1
Sequence:CCGGGCAGGACTGAATATCTTCTTTCTCGAGAAAGAAGATATTCAGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009102
RRH MISSION shRNA Lentiviral Transduction Particles
retinal pigment epithelium-derived rhodopsin homolog
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-713s1c1
Sequence:CCGGCCAGGCAGATGTAACAAAGATCTCGAGATCTTTGTTACATCTGCCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-773s1c1
Sequence:CCGGCCCTTATTCCATCGTGTGCTTCTCGAGAAGCACACGATGGAATAAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-149s1c1
Sequence:CCGGCCTGGGTATCTTCATCAAGTACTCGAGTACTTGATGAAGATACCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-548s1c1
Sequence:CCGGGCGGAATAATGATACCTCGTTCTCGAGAACGAGGTATCATTATTCCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009102.2-315s1c1
Sequence:CCGGGCAGGACTGAATATCTTCTTTCTCGAGAAAGAAGATATTCAGTCCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???