EMAIL THIS PAGE TO A FRIEND

RRM1

ribonucleotide reductase M1

76 Gene Product Result for
Synonyms: R1 RIR1 RR1
UniProtKB ID: P23921, Q9UNN2
Gene ID:
Human(6240) Summary: This gene encodes one of two non-identical subunits that constitute ribonucleoside-diphosphate reductase, an enzyme essential for the production of deoxyribonucleotides prior to DNA synthesis in S phase of dividing cells. It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region. [provided by RefSeq, Jul 2008]
Mouse(20133) ribonucleotide reductase M1
Rat(685579) ribonucleotide reductase M1
Zebrafish(30740) ribonucleotide reductase M1 polypeptide
chicken(419081) ribonucleotide reductase M1
domestic cat(101097343) ribonucleotide reductase M1
Horse(100053126) ribonucleotide reductase M1
dog(476823) ribonucleotide reductase M1
Domestic Rabbit(100345823) ribonucleotide reductase M1
naked mole-rat(101708047) ribonucleotide reductase M1
domestic guinea pig(100728488) ribonucleotide reductase M1
cow(505537) ribonucleotide reductase M1
sheep(101116171) ribonucleotide reductase M1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033 Rosetta Predictions human pricing
XM_001064405 Rosetta Predictions rat pricing
NM_009103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307961 predicted 2234
2 SASI_Hs01_00066939 predicted 388
3 SASI_Hs01_00066940 predicted 1980
4 SASI_Hs01_00066942 predicted 736
5 SASI_Hs01_00066943 predicted 722
6 SASI_Hs01_00066944 predicted 1345
7 SASI_Hs01_00066945 predicted 631
8 SASI_Hs01_00066946 predicted 439
9 SASI_Hs02_00307962 predicted 520
10 SASI_Hs01_00066947 predicted 1326
11 SASI_Hs01_00066938 predicted 920
12 SASI_Hs01_00066941 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310344 predicted 407
2 SASI_Rn02_00310345 predicted 442
3 SASI_Rn02_00310346 predicted 426
4 SASI_Rn02_00310347 predicted 393
5 SASI_Rn02_00310348 predicted 340
6 SASI_Rn02_00310349 predicted 396
7 SASI_Rn02_00310350 predicted 423
8 SASI_Rn02_00310351 predicted 380
9 SASI_Rn02_00310352 predicted 338
10 SASI_Rn02_00310353 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131073 predicted 2072
2 SASI_Mm01_00131074 predicted 2578
3 SASI_Mm01_00131075 predicted 1062
4 SASI_Mm01_00131076 predicted 978
5 SASI_Mm01_00131077 predicted 558
6 SASI_Mm01_00131078 predicted 1186
7 SASI_Mm01_00131079 predicted 283
8 SASI_Mm01_00131080 predicted 441
9 SASI_Mm01_00131081 predicted 584
10 SASI_Mm02_00315360 predicted 553
11 SASI_Mm01_00131082 predicted 2606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009103
VALIDATED
RRM1 MISSION shRNA Bacterial Glycerol Stock
ribonucleotide reductase M1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009103.2-1134s1c1
Sequence:CCGGCGCGATCTCTTCTTTGCACTTCTCGAGAAGTGCAAAGAAGAGATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009103.2-402s1c1
Sequence:CCGGGCCGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009103.2-2730s1c1
Sequence:CCGGGCCAGCTTTGATATTAGGAATCTCGAGATTCCTAATATCAAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009103.2-559s1c1
Sequence:CCGGCCATTATCTATGACCGAGATTCTCGAGAATCTCGGTCATAGATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009103.2-2345s1c1
Sequence:CCGGGCAGGGTTTAAAGACTGGAATCTCGAGATTCCAGTCTTTAAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009103
VALIDATED
RRM1 MISSION shRNA shRNA Plasmid DNA
ribonucleotide reductase M1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009103.2-1134s1c1
Sequence:CCGGCGCGATCTCTTCTTTGCACTTCTCGAGAAGTGCAAAGAAGAGATCGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009103.2-402s1c1
Sequence:CCGGGCCGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009103.2-2730s1c1
Sequence:CCGGGCCAGCTTTGATATTAGGAATCTCGAGATTCCTAATATCAAAGCTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009103.2-559s1c1
Sequence:CCGGCCATTATCTATGACCGAGATTCTCGAGAATCTCGGTCATAGATAATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009103.2-2345s1c1
Sequence:CCGGGCAGGGTTTAAAGACTGGAATCTCGAGATTCCAGTCTTTAAACCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009103
VALIDATED
RRM1 MISSION shRNA Lentiviral Transduction Particles
ribonucleotide reductase M1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009103.2-1134s1c1
Sequence:CCGGCGCGATCTCTTCTTTGCACTTCTCGAGAAGTGCAAAGAAGAGATCGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009103.2-402s1c1
Sequence:CCGGGCCGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009103.2-2730s1c1
Sequence:CCGGGCCAGCTTTGATATTAGGAATCTCGAGATTCCTAATATCAAAGCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009103.2-559s1c1
Sequence:CCGGCCATTATCTATGACCGAGATTCTCGAGAATCTCGGTCATAGATAATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009103.2-2345s1c1
Sequence:CCGGGCAGGGTTTAAAGACTGGAATCTCGAGATTCCAGTCTTTAAACCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033
VALIDATED
RRM1 MISSION shRNA Bacterial Glycerol Stock
ribonucleotide reductase M1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-476s1c1
Sequence:CCGGGCTGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-2471s1c1
Sequence:CCGGCCAATCCAGTTCACTCTAAATCTCGAGATTTAGAGTGAACTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-868s1c1
Sequence:CCGGCCCACAACTTTCTAGCTGTTTCTCGAGAAACAGCTAGAAAGTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-2369s1c1
Sequence:CCGGGCTGAGCCTAACTATGGCAAACTCGAGTTTGCCATAGTTAGGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-2558s21c1
Sequence:CCGGCCAATCCAGTTCACTCTAAATCTCGAGATTTAGAGTGAACTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-563s21c1
Sequence:CCGGGCTGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-955s21c1
Sequence:CCGGCCCACAACTTTCTAGCTGTTTCTCGAGAAACAGCTAGAAAGTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-2456s21c1
Sequence:CCGGGCTGAGCCTAACTATGGCAAACTCGAGTTTGCCATAGTTAGGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033
VALIDATED
RRM1 MISSION shRNA shRNA Plasmid DNA
ribonucleotide reductase M1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-476s1c1
Sequence:CCGGGCTGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000038968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-2471s1c1
Sequence:CCGGCCAATCCAGTTCACTCTAAATCTCGAGATTTAGAGTGAACTGGATTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000038964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-868s1c1
Sequence:CCGGCCCACAACTTTCTAGCTGTTTCTCGAGAAACAGCTAGAAAGTTGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000038966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-2369s1c1
Sequence:CCGGGCTGAGCCTAACTATGGCAAACTCGAGTTTGCCATAGTTAGGCTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-2558s21c1
Sequence:CCGGCCAATCCAGTTCACTCTAAATCTCGAGATTTAGAGTGAACTGGATTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-563s21c1
Sequence:CCGGGCTGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-955s21c1
Sequence:CCGGCCCACAACTTTCTAGCTGTTTCTCGAGAAACAGCTAGAAAGTTGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-2456s21c1
Sequence:CCGGGCTGAGCCTAACTATGGCAAACTCGAGTTTGCCATAGTTAGGCTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033
VALIDATED
RRM1 MISSION shRNA Lentiviral Transduction Particles
ribonucleotide reductase M1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-476s1c1
Sequence:CCGGGCTGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-2471s1c1
Sequence:CCGGCCAATCCAGTTCACTCTAAATCTCGAGATTTAGAGTGAACTGGATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-868s1c1
Sequence:CCGGCCCACAACTTTCTAGCTGTTTCTCGAGAAACAGCTAGAAAGTTGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033.2-2369s1c1
Sequence:CCGGGCTGAGCCTAACTATGGCAAACTCGAGTTTGCCATAGTTAGGCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-2558s21c1
Sequence:CCGGCCAATCCAGTTCACTCTAAATCTCGAGATTTAGAGTGAACTGGATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-563s21c1
Sequence:CCGGGCTGTCTCTAACTTGCACAAACTCGAGTTTGTGCAAGTTAGAGACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-955s21c1
Sequence:CCGGCCCACAACTTTCTAGCTGTTTCTCGAGAAACAGCTAGAAAGTTGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033.3-2456s21c1
Sequence:CCGGGCTGAGCCTAACTATGGCAAACTCGAGTTTGCCATAGTTAGGCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???