EMAIL THIS PAGE TO A FRIEND

RRM2

ribonucleotide reductase M2

62 Gene Product Result for
Synonyms: R2 RR2 RR2M
UniProtKB ID: P31350, B2R9B5, J3KP43, Q5WRU7
Gene ID:
Human(6241) Summary: This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Mouse(20135) ribonucleotide reductase M2
Rat(362720) ribonucleotide reductase M2
domestic guinea pig(100715474) ribonucleotide reductase M2
naked mole-rat(101700655) ribonucleotide reductase M2
cow(508167) ribonucleotide reductase M2
sheep(101118093) ribonucleotide reductase M2
Zebrafish(30733) ribonucleotide reductase M2 polypeptide
Horse(100072410) ribonucleotide reductase M2
domestic cat(101087987) ribonucleotide reductase M2
dog(482963) ribonucleotide reductase M2
chicken(421936) ribonucleotide reductase M2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034 Rosetta Predictions human pricing
NM_001025740 Rosetta Predictions rat pricing
NM_009104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214161 predicted 727
2 SASI_Hs01_00214162 predicted 1052
3 SASI_Hs01_00214163 predicted 626
4 SASI_Hs01_00214164 predicted 697
5 SASI_Hs01_00214165 predicted 453
6 SASI_Hs01_00214166 predicted 749
7 SASI_Hs01_00214167 predicted 1128
8 SASI_Hs01_00214168 predicted 1152
9 SASI_Hs01_00214169 predicted 1162
10 SASI_Hs01_00214170 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079170 predicted 615
2 SASI_Rn02_00203378 predicted 1192
3 SASI_Rn01_00079173 predicted 819
4 SASI_Rn01_00079174 predicted 1100
5 SASI_Rn01_00079175 predicted 1041
6 SASI_Rn02_00203379 predicted 280
7 SASI_Rn02_00203380 predicted 1282
8 SASI_Rn01_00079177 predicted 532
9 SASI_Rn01_00079178 predicted 563
10 SASI_Rn02_00203381 predicted 1198
11 SASI_Rn01_00079171 predicted 1094
12 SASI_Rn01_00079172 predicted 863
13 SASI_Rn01_00079176 predicted 318
14 SASI_Rn01_00079179 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315361 predicted 864
2 SASI_Mm02_00315362 predicted 1010
3 SASI_Mm01_00077885 predicted 328
4 SASI_Mm01_00077892 predicted 1128
5 SASI_Mm01_00077886 predicted 590
6 SASI_Mm01_00077893 predicted 1050
7 SASI_Mm01_00077887 predicted 612
8 SASI_Mm02_00315363 predicted 623
9 SASI_Mm01_00077888 predicted 230
10 SASI_Mm01_00077889 predicted 533
11 SASI_Mm01_00077890 predicted 606
12 SASI_Mm01_00077891 predicted 1046
13 SASI_Mm01_00077894 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009104
VALIDATED
RRM2 MISSION shRNA Bacterial Glycerol Stock
ribonucleotide reductase M2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-307s21c1
Sequence:CCGGCGTTGTCTTTCCCATCGAGTACTCGAGTACTCGATGGGAAAGACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-1125s21c1
Sequence:CCGGTCTCACTAGAAGGAAAGACAACTCGAGTTGTCTTTCCTTCTAGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-938s21c1
Sequence:CCGGGAGATAATCACCAACGCCGTTCTCGAGAACGGCGTTGGTGATTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-328s21c1
Sequence:CCGGCCATGATATCTGGCAGATGTACTCGAGTACATCTGCCAGATATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-473s21c1
Sequence:CCGGGCGAGTGATGGCATAGTCAATCTCGAGATTGACTATGCCATCACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-307s1c1
Sequence:CCGGCGTTGTCTTTCCCATCGAGTACTCGAGTACTCGATGGGAAAGACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009104.1-1733s1c1
Sequence:CCGGGCTCAGTATTATCTTGAAGTTCTCGAGAACTTCAAGATAATACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-1194s1c1
Sequence:CCGGCGAATTCGACAGAGAACTCTTCTCGAGAAGAGTTCTCTGTCGAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009104.1-1792s1c1
Sequence:CCGGCCCTAATAAGAGTGTCACTTTCTCGAGAAAGTGACACTCTTATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-599s1c1
Sequence:CCGGCTCCTTATTGACACTTACATTCTCGAGAATGTAAGTGTCAATAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-542s1c1
Sequence:CCGGCGCTGTTTCTATGGCTTCCAACTCGAGTTGGAAGCCATAGAAACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-473s1c1
Sequence:CCGGGCGAGTGATGGCATAGTCAATCTCGAGATTGACTATGCCATCACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-938s1c1
Sequence:CCGGGAGATAATCACCAACGCCGTTCTCGAGAACGGCGTTGGTGATTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-328s1c1
Sequence:CCGGCCATGATATCTGGCAGATGTACTCGAGTACATCTGCCAGATATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-1125s1c1
Sequence:CCGGTCTCACTAGAAGGAAAGACAACTCGAGTTGTCTTTCCTTCTAGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009104
VALIDATED
RRM2 MISSION shRNA shRNA Plasmid DNA
ribonucleotide reductase M2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-307s21c1
Sequence:CCGGCGTTGTCTTTCCCATCGAGTACTCGAGTACTCGATGGGAAAGACAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-1125s21c1
Sequence:CCGGTCTCACTAGAAGGAAAGACAACTCGAGTTGTCTTTCCTTCTAGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-938s21c1
Sequence:CCGGGAGATAATCACCAACGCCGTTCTCGAGAACGGCGTTGGTGATTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-328s21c1
Sequence:CCGGCCATGATATCTGGCAGATGTACTCGAGTACATCTGCCAGATATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-473s21c1
Sequence:CCGGGCGAGTGATGGCATAGTCAATCTCGAGATTGACTATGCCATCACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-307s1c1
Sequence:CCGGCGTTGTCTTTCCCATCGAGTACTCGAGTACTCGATGGGAAAGACAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009104.1-1733s1c1
Sequence:CCGGGCTCAGTATTATCTTGAAGTTCTCGAGAACTTCAAGATAATACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-1194s1c1
Sequence:CCGGCGAATTCGACAGAGAACTCTTCTCGAGAAGAGTTCTCTGTCGAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009104.1-1792s1c1
Sequence:CCGGCCCTAATAAGAGTGTCACTTTCTCGAGAAAGTGACACTCTTATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-599s1c1
Sequence:CCGGCTCCTTATTGACACTTACATTCTCGAGAATGTAAGTGTCAATAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-542s1c1
Sequence:CCGGCGCTGTTTCTATGGCTTCCAACTCGAGTTGGAAGCCATAGAAACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-473s1c1
Sequence:CCGGGCGAGTGATGGCATAGTCAATCTCGAGATTGACTATGCCATCACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-938s1c1
Sequence:CCGGGAGATAATCACCAACGCCGTTCTCGAGAACGGCGTTGGTGATTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-328s1c1
Sequence:CCGGCCATGATATCTGGCAGATGTACTCGAGTACATCTGCCAGATATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-1125s1c1
Sequence:CCGGTCTCACTAGAAGGAAAGACAACTCGAGTTGTCTTTCCTTCTAGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009104
VALIDATED
RRM2 MISSION shRNA Lentiviral Transduction Particles
ribonucleotide reductase M2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-307s21c1
Sequence:CCGGCGTTGTCTTTCCCATCGAGTACTCGAGTACTCGATGGGAAAGACAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000324723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-1125s21c1
Sequence:CCGGTCTCACTAGAAGGAAAGACAACTCGAGTTGTCTTTCCTTCTAGTGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-938s21c1
Sequence:CCGGGAGATAATCACCAACGCCGTTCTCGAGAACGGCGTTGGTGATTATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-328s21c1
Sequence:CCGGCCATGATATCTGGCAGATGTACTCGAGTACATCTGCCAGATATCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009104.1-473s21c1
Sequence:CCGGGCGAGTGATGGCATAGTCAATCTCGAGATTGACTATGCCATCACTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-307s1c1
Sequence:CCGGCGTTGTCTTTCCCATCGAGTACTCGAGTACTCGATGGGAAAGACAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009104.1-1733s1c1
Sequence:CCGGGCTCAGTATTATCTTGAAGTTCTCGAGAACTTCAAGATAATACTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-1194s1c1
Sequence:CCGGCGAATTCGACAGAGAACTCTTCTCGAGAAGAGTTCTCTGTCGAATTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009104.1-1792s1c1
Sequence:CCGGCCCTAATAAGAGTGTCACTTTCTCGAGAAAGTGACACTCTTATTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-599s1c1
Sequence:CCGGCTCCTTATTGACACTTACATTCTCGAGAATGTAAGTGTCAATAAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-542s1c1
Sequence:CCGGCGCTGTTTCTATGGCTTCCAACTCGAGTTGGAAGCCATAGAAACAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-473s1c1
Sequence:CCGGGCGAGTGATGGCATAGTCAATCTCGAGATTGACTATGCCATCACTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-938s1c1
Sequence:CCGGGAGATAATCACCAACGCCGTTCTCGAGAACGGCGTTGGTGATTATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009104.1-328s1c1
Sequence:CCGGCCATGATATCTGGCAGATGTACTCGAGTACATCTGCCAGATATCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009104.1-1125s1c1
Sequence:CCGGTCTCACTAGAAGGAAAGACAACTCGAGTTGTCTTTCCTTCTAGTGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034
VALIDATED
RRM2 MISSION shRNA Bacterial Glycerol Stock
ribonucleotide reductase M2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1173s21c1
Sequence:CCGGGCAGACAGACTTATGCTGGAACTCGAGTTCCAGCATAAGTCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1226s21c1
Sequence:CCGGCCCATTTGACTTTATGGAGAACTCGAGTTCTCCATAAAGTCAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-926s21c1
Sequence:CCGGGCTCAAGAAACGAGGACTGATCTCGAGATCAGTCCTCGTTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1765s21c1
Sequence:CCGGTGTACTCACAAGGCGATAATACTCGAGTATTATCGCCTTGTGAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-929s1c1
Sequence:CCGGGCTCAAGAAACGAGGACTGATCTCGAGATCAGTCCTCGTTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-1176s1c1
Sequence:CCGGGCAGACAGACTTATGCTGGAACTCGAGTTCCAGCATAAGTCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034.1-467s1c1
Sequence:CCGGGCAGATGTATAAGAAGGCAGACTCGAGTCTGCCTTCTTATACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001034.1-1048s1c1
Sequence:CCGGCGGAGGAGAGAGTAAGAGAAACTCGAGTTTCTCTTACTCTCTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-1229s1c1
Sequence:CCGGCCCATTTGACTTTATGGAGAACTCGAGTTCTCCATAAAGTCAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1045s21c1
Sequence:CCGGCGGAGGAGAGAGTAAGAGAAACTCGAGTTTCTCTTACTCTCTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034
VALIDATED
RRM2 MISSION shRNA shRNA Plasmid DNA
ribonucleotide reductase M2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1173s21c1
Sequence:CCGGGCAGACAGACTTATGCTGGAACTCGAGTTCCAGCATAAGTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1226s21c1
Sequence:CCGGCCCATTTGACTTTATGGAGAACTCGAGTTCTCCATAAAGTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-926s21c1
Sequence:CCGGGCTCAAGAAACGAGGACTGATCTCGAGATCAGTCCTCGTTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1765s21c1
Sequence:CCGGTGTACTCACAAGGCGATAATACTCGAGTATTATCGCCTTGTGAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-929s1c1
Sequence:CCGGGCTCAAGAAACGAGGACTGATCTCGAGATCAGTCCTCGTTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-1176s1c1
Sequence:CCGGGCAGACAGACTTATGCTGGAACTCGAGTTCCAGCATAAGTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034.1-467s1c1
Sequence:CCGGGCAGATGTATAAGAAGGCAGACTCGAGTCTGCCTTCTTATACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001034.1-1048s1c1
Sequence:CCGGCGGAGGAGAGAGTAAGAGAAACTCGAGTTTCTCTTACTCTCTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-1229s1c1
Sequence:CCGGCCCATTTGACTTTATGGAGAACTCGAGTTCTCCATAAAGTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1045s21c1
Sequence:CCGGCGGAGGAGAGAGTAAGAGAAACTCGAGTTTCTCTTACTCTCTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034
VALIDATED
RRM2 MISSION shRNA Lentiviral Transduction Particles
ribonucleotide reductase M2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1173s21c1
Sequence:CCGGGCAGACAGACTTATGCTGGAACTCGAGTTCCAGCATAAGTCTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000286355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1226s21c1
Sequence:CCGGCCCATTTGACTTTATGGAGAACTCGAGTTCTCCATAAAGTCAAATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000286352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-926s21c1
Sequence:CCGGGCTCAAGAAACGAGGACTGATCTCGAGATCAGTCCTCGTTTCTTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000293877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1765s21c1
Sequence:CCGGTGTACTCACAAGGCGATAATACTCGAGTATTATCGCCTTGTGAGTACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-929s1c1
Sequence:CCGGGCTCAAGAAACGAGGACTGATCTCGAGATCAGTCCTCGTTTCTTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-1176s1c1
Sequence:CCGGGCAGACAGACTTATGCTGGAACTCGAGTTCCAGCATAAGTCTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034.1-467s1c1
Sequence:CCGGGCAGATGTATAAGAAGGCAGACTCGAGTCTGCCTTCTTATACATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001034.1-1048s1c1
Sequence:CCGGCGGAGGAGAGAGTAAGAGAAACTCGAGTTTCTCTTACTCTCTCCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001034.1-1229s1c1
Sequence:CCGGCCCATTTGACTTTATGGAGAACTCGAGTTCTCCATAAAGTCAAATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000286354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001034.2-1045s21c1
Sequence:CCGGCGGAGGAGAGAGTAAGAGAAACTCGAGTTTCTCTTACTCTCTCCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???