EMAIL THIS PAGE TO A FRIEND

RRM2B

ribonucleotide reductase M2 B (TP53 inducible)

129 Gene Product Result for
Synonyms: MTDPS8A MTDPS8B P53R2
Gene ID:
Human(50484) Summary: This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Mouse(382985) ribonucleotide reductase M2 B (TP53 inducible)
Rat(299976) ribonucleotide reductase M2 B (TP53 inducible)
cow(528960) ribonucleotide reductase M2 B (TP53 inducible)
sheep(101123639) ribonucleotide reductase M2 B (TP53 inducible)
naked mole-rat(101718446) ribonucleotide reductase M2 B (TP53 inducible)
domestic guinea pig(100715485) ribonucleotide reductase M2 B (TP53 inducible)
Zebrafish(368909) ribonucleotide reductase M2 b
chicken(420253) ribonucleotide reductase M2 B (TP53 inducible)
Horse(100062030) ribonucleotide reductase M2 B (TP53 inducible)
domestic cat(101099777) ribonucleotide reductase M2 B (TP53 inducible)
dog(481988) ribonucleotide reductase M2 B (TP53 inducible)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015713 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142661 MISSION® esiRNA esiRNA human RRM2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015713 Rosetta Predictions human pricing
NM_001130543 Rosetta Predictions rat pricing
NM_199476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029488 predicted 666
2 SASI_Hs01_00029490 predicted 660
3 SASI_Hs01_00029491 predicted 643
4 SASI_Hs01_00029492 predicted 1095
5 SASI_Hs01_00029493 predicted 475
6 SASI_Hs01_00029494 predicted 763
7 SASI_Hs01_00029495 predicted 1083
8 SASI_Hs02_00348388 predicted 950
9 SASI_Hs01_00029496 predicted 877
10 SASI_Hs01_00029497 predicted 328
11 SASI_Hs01_00029489 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255609 predicted 972
2 SASI_Rn02_00255610 predicted 504
3 SASI_Rn02_00255611 predicted 648
4 SASI_Rn02_00255612 predicted 808
5 SASI_Rn02_00255613 predicted 555
6 SASI_Rn02_00255614 predicted 737
7 SASI_Rn02_00255615 predicted 538
8 SASI_Rn02_00255616 predicted 883
9 SASI_Rn02_00255617 predicted 495
10 SASI_Rn02_00255618 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098540 predicted 202
2 SASI_Mm01_00098541 predicted 520
3 SASI_Mm01_00098542 predicted 535
4 SASI_Mm01_00098544 predicted 309
5 SASI_Mm01_00098545 predicted 285
6 SASI_Mm01_00098546 predicted 591
7 SASI_Mm02_00351481 predicted 302
8 SASI_Mm01_00098547 predicted 906
9 SASI_Mm01_00098548 predicted 578
10 SASI_Mm01_00098549 predicted 566
11 SASI_Mm01_00098543 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199476
VALIDATED
RRM2B MISSION shRNA Bacterial Glycerol Stock
ribonucleotide reductase M2 B (TP53 inducible)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-570s21c1
Sequence:CCGGGAGATGTACAGTTTACTAATACTCGAGTATTAGTAAACTGTACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-1439s21c1
Sequence:CCGGGAAACTTTCAGTATCTCATTTCTCGAGAAATGAGATACTGAAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199476.1-760s1c1
Sequence:CCGGCTGGATCATTTGCTGCAATATCTCGAGATATTGCAGCAAATGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-290s1c1
Sequence:CCGGCGTCATCTTTCCAATCCAGTACTCGAGTACTGGATTGGAAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-875s1c1
Sequence:CCGGGATGTTTCAGTACTTGGTAAACTCGAGTTTACCAAGTACTGAAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-454s1c1
Sequence:CCGGCAGCCAGTGATGGAATTGTAACTCGAGTTACAATTCCATCACTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-290s21c1
Sequence:CCGGCGTCATCTTTCCAATCCAGTACTCGAGTACTGGATTGGAAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-454s21c1
Sequence:CCGGCAGCCAGTGATGGAATTGTAACTCGAGTTACAATTCCATCACTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-1172s1c1
Sequence:CCGGCATGGCCGAAACCACAGATAACTCGAGTTATCTGTGGTTTCGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-391s21c1
Sequence:CCGGCTCACTGGAACAAGCTTAAATCTCGAGATTTAAGCTTGTTCCAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199476
VALIDATED
RRM2B MISSION shRNA shRNA Plasmid DNA
ribonucleotide reductase M2 B (TP53 inducible)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-570s21c1
Sequence:CCGGGAGATGTACAGTTTACTAATACTCGAGTATTAGTAAACTGTACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-1439s21c1
Sequence:CCGGGAAACTTTCAGTATCTCATTTCTCGAGAAATGAGATACTGAAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199476.1-760s1c1
Sequence:CCGGCTGGATCATTTGCTGCAATATCTCGAGATATTGCAGCAAATGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-290s1c1
Sequence:CCGGCGTCATCTTTCCAATCCAGTACTCGAGTACTGGATTGGAAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-875s1c1
Sequence:CCGGGATGTTTCAGTACTTGGTAAACTCGAGTTTACCAAGTACTGAAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-454s1c1
Sequence:CCGGCAGCCAGTGATGGAATTGTAACTCGAGTTACAATTCCATCACTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-290s21c1
Sequence:CCGGCGTCATCTTTCCAATCCAGTACTCGAGTACTGGATTGGAAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-454s21c1
Sequence:CCGGCAGCCAGTGATGGAATTGTAACTCGAGTTACAATTCCATCACTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-1172s1c1
Sequence:CCGGCATGGCCGAAACCACAGATAACTCGAGTTATCTGTGGTTTCGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-391s21c1
Sequence:CCGGCTCACTGGAACAAGCTTAAATCTCGAGATTTAAGCTTGTTCCAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199476
VALIDATED
RRM2B MISSION shRNA Lentiviral Transduction Particles
ribonucleotide reductase M2 B (TP53 inducible)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-570s21c1
Sequence:CCGGGAGATGTACAGTTTACTAATACTCGAGTATTAGTAAACTGTACATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-1439s21c1
Sequence:CCGGGAAACTTTCAGTATCTCATTTCTCGAGAAATGAGATACTGAAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199476.1-760s1c1
Sequence:CCGGCTGGATCATTTGCTGCAATATCTCGAGATATTGCAGCAAATGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-290s1c1
Sequence:CCGGCGTCATCTTTCCAATCCAGTACTCGAGTACTGGATTGGAAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-875s1c1
Sequence:CCGGGATGTTTCAGTACTTGGTAAACTCGAGTTTACCAAGTACTGAAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-454s1c1
Sequence:CCGGCAGCCAGTGATGGAATTGTAACTCGAGTTACAATTCCATCACTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-290s21c1
Sequence:CCGGCGTCATCTTTCCAATCCAGTACTCGAGTACTGGATTGGAAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-454s21c1
Sequence:CCGGCAGCCAGTGATGGAATTGTAACTCGAGTTACAATTCCATCACTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199476.1-1172s1c1
Sequence:CCGGCATGGCCGAAACCACAGATAACTCGAGTTATCTGTGGTTTCGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199476.1-391s21c1
Sequence:CCGGCTCACTGGAACAAGCTTAAATCTCGAGATTTAAGCTTGTTCCAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015713
VALIDATED
RRM2B MISSION shRNA Bacterial Glycerol Stock
ribonucleotide reductase M2 B (TP53 inducible)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-763s1c1
Sequence:CCGGGCGATGGATAGCAGATAGAAACTCGAGTTTCTATCTGCTATCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-763s21c1
Sequence:CCGGGCGATGGATAGCAGATAGAAACTCGAGTTTCTATCTGCTATCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-865s1c1
Sequence:CCGGGCTAAAGAAGAGAGGTCTTATCTCGAGATAAGACCTCTCTTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-364s1c1
Sequence:CCGGCCGGTTTGTCATCTTTCCAATCTCGAGATTGGAAAGATGACAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-533s1c1
Sequence:CCGGGCAGCCAGTGATGGAATTGTACTCGAGTACAATTCCATCACTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-1112s1c1
Sequence:CCGGGCTGACAGATTACTTGTGGAACTCGAGTTCCACAAGTAATCTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-533s21c1
Sequence:CCGGGCAGCCAGTGATGGAATTGTACTCGAGTACAATTCCATCACTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-865s21c1
Sequence:CCGGGCTAAAGAAGAGAGGTCTTATCTCGAGATAAGACCTCTCTTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-364s21c1
Sequence:CCGGCCGGTTTGTCATCTTTCCAATCTCGAGATTGGAAAGATGACAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015713
VALIDATED
RRM2B MISSION shRNA shRNA Plasmid DNA
ribonucleotide reductase M2 B (TP53 inducible)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-763s1c1
Sequence:CCGGGCGATGGATAGCAGATAGAAACTCGAGTTTCTATCTGCTATCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-763s21c1
Sequence:CCGGGCGATGGATAGCAGATAGAAACTCGAGTTTCTATCTGCTATCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-865s1c1
Sequence:CCGGGCTAAAGAAGAGAGGTCTTATCTCGAGATAAGACCTCTCTTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-364s1c1
Sequence:CCGGCCGGTTTGTCATCTTTCCAATCTCGAGATTGGAAAGATGACAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-533s1c1
Sequence:CCGGGCAGCCAGTGATGGAATTGTACTCGAGTACAATTCCATCACTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-1112s1c1
Sequence:CCGGGCTGACAGATTACTTGTGGAACTCGAGTTCCACAAGTAATCTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-533s21c1
Sequence:CCGGGCAGCCAGTGATGGAATTGTACTCGAGTACAATTCCATCACTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-865s21c1
Sequence:CCGGGCTAAAGAAGAGAGGTCTTATCTCGAGATAAGACCTCTCTTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-364s21c1
Sequence:CCGGCCGGTTTGTCATCTTTCCAATCTCGAGATTGGAAAGATGACAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015713
VALIDATED
RRM2B MISSION shRNA Lentiviral Transduction Particles
ribonucleotide reductase M2 B (TP53 inducible)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-763s1c1
Sequence:CCGGGCGATGGATAGCAGATAGAAACTCGAGTTTCTATCTGCTATCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-763s21c1
Sequence:CCGGGCGATGGATAGCAGATAGAAACTCGAGTTTCTATCTGCTATCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-865s1c1
Sequence:CCGGGCTAAAGAAGAGAGGTCTTATCTCGAGATAAGACCTCTCTTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-364s1c1
Sequence:CCGGCCGGTTTGTCATCTTTCCAATCTCGAGATTGGAAAGATGACAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-533s1c1
Sequence:CCGGGCAGCCAGTGATGGAATTGTACTCGAGTACAATTCCATCACTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015713.3-1112s1c1
Sequence:CCGGGCTGACAGATTACTTGTGGAACTCGAGTTCCACAAGTAATCTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-533s21c1
Sequence:CCGGGCAGCCAGTGATGGAATTGTACTCGAGTACAATTCCATCACTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-865s21c1
Sequence:CCGGGCTAAAGAAGAGAGGTCTTATCTCGAGATAAGACCTCTCTTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015713.3-364s21c1
Sequence:CCGGCCGGTTTGTCATCTTTCCAATCTCGAGATTGGAAAGATGACAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)