EMAIL THIS PAGE TO A FRIEND

RRN3

RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)

126 Gene Product Result for
Synonyms: A-270G1.2 TIFIA
UniProtKB ID: Q9NYV6, A2RTY9, Q6IPL4, Q9H4F0
Gene ID:
Mouse(106298) RRN3 RNA polymerase I transcription factor homolog (yeast)
Rat(304714) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Zebrafish(558718) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Horse(100054032) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
domestic cat(101080854) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
dog(479838) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
chicken(416414) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
domestic guinea pig(100735506) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
naked mole-rat(101725509) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Domestic Rabbit(100346876) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
cow(515964) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
sheep(101113119) RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_358764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018427 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018427 Rosetta Predictions human pricing
XM_001053401 Rosetta Predictions rat pricing
XM_001075799 Rosetta Predictions rat pricing
XM_001075816 Rosetta Predictions rat pricing
XM_222526 Rosetta Predictions rat pricing
NM_001039521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078068 predicted 1050
2 SASI_Hs02_00351941 predicted 344
3 SASI_Hs02_00351942 predicted 1787
4 SASI_Hs01_00078070 predicted 1082
5 SASI_Hs02_00351943 predicted 412
6 SASI_Hs01_00078073 predicted 420
7 SASI_Hs01_00078074 predicted 376
8 SASI_Hs02_00351944 predicted 819
9 SASI_Hs01_00078076 predicted 268
10 SASI_Hs01_00078077 predicted 1408
11 SASI_Hs01_00078069 predicted 1522
12 SASI_Hs01_00078071 predicted 1242
13 SASI_Hs01_00078072 predicted 822
14 SASI_Hs01_00078075 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272206 predicted 770
2 SASI_Rn02_00272207 predicted 1736
3 SASI_Rn02_00272208 predicted 355
4 SASI_Rn02_00272209 predicted 2020
5 SASI_Rn02_00272210 predicted 730
6 SASI_Rn02_00272211 predicted 2000
7 SASI_Rn02_00272212 predicted 488
8 SASI_Rn02_00272213 predicted 1727
9 SASI_Rn02_00272214 predicted 1774
10 SASI_Rn02_00272215 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351090 predicted 769
2 SASI_Rn02_00351091 predicted 1741
3 SASI_Rn02_00351092 predicted 357
4 SASI_Rn02_00351093 predicted 732
5 SASI_Rn02_00351094 predicted 497
6 SASI_Rn02_00351095 predicted 1726
7 SASI_Rn02_00351096 predicted 221
8 SASI_Rn02_00351097 predicted 1774
9 SASI_Rn02_00351098 predicted 370
10 SASI_Rn02_00351099 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351149 predicted 768
2 SASI_Rn02_00351150 predicted 1739
3 SASI_Rn02_00351151 predicted 359
4 SASI_Rn02_00351152 predicted 2016
5 SASI_Rn02_00351153 predicted 734
6 SASI_Rn02_00351154 predicted 489
7 SASI_Rn02_00351155 predicted 1730
8 SASI_Rn02_00351156 predicted 1773
9 SASI_Rn02_00351157 predicted 371
10 SASI_Rn02_00351158 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380765 predicted 771
2 SASI_Rn02_00380766 predicted 363
3 SASI_Rn02_00380767 predicted 729
4 SASI_Rn02_00380768 predicted 489
5 SASI_Rn02_00380769 predicted 715
6 SASI_Rn02_00380770 predicted 371
7 SASI_Rn02_00380771 predicted 745
8 SASI_Rn02_00380772 predicted 726
9 SASI_Rn02_00380773 predicted 371
10 SASI_Rn02_00380774 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169894 predicted 816
2 SASI_Mm01_00169895 predicted 364
3 SASI_Mm02_00290116 predicted 337
4 SASI_Mm02_00290117 predicted 1741
5 SASI_Mm01_00169897 predicted 310
6 SASI_Mm01_00169898 predicted 577
7 SASI_Mm01_00169899 predicted 800
8 SASI_Mm01_00169900 predicted 366
9 SASI_Mm01_00169901 predicted 729
10 SASI_Mm02_00290118 predicted 758
11 SASI_Mm01_00169893 predicted 1285
12 SASI_Mm01_00169896 predicted 1140
13 SASI_Mm01_00169902 predicted 1557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039521
VALIDATED
RRN3 MISSION shRNA Bacterial Glycerol Stock
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000346697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039521.1-1764s21c1
Sequence:CCGGAGAAGTTCATTGATCCTATTTCTCGAGAAATAGGATCAATGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039521.1-760s21c1
Sequence:CCGGCCCAACTTTGAGGCGTGAAATCTCGAGATTTCACGCCTCAAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039521
VALIDATED
RRN3 MISSION shRNA shRNA Plasmid DNA
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000346697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039521.1-1764s21c1
Sequence:CCGGAGAAGTTCATTGATCCTATTTCTCGAGAAATAGGATCAATGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039521.1-760s21c1
Sequence:CCGGCCCAACTTTGAGGCGTGAAATCTCGAGATTTCACGCCTCAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039521
VALIDATED
RRN3 MISSION shRNA Lentiviral Transduction Particles
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000346697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039521.1-1764s21c1
Sequence:CCGGAGAAGTTCATTGATCCTATTTCTCGAGAAATAGGATCAATGAACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039521.1-760s21c1
Sequence:CCGGCCCAACTTTGAGGCGTGAAATCTCGAGATTTCACGCCTCAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358764
VALIDATED
RRN3 MISSION shRNA Bacterial Glycerol Stock
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000119923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-764s1c1
Sequence:CCGGCCCAACTTTGAGGCGTGAAATCTCGAGATTTCACGCCTCAAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358764.1-1266s1c1
Sequence:CCGGGCAAATTATATTGGGAGCTTTCTCGAGAAAGCTCCCAATATAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-3083s1c1
Sequence:CCGGCCTGAATTTCATTCTGTCTATCTCGAGATAGACAGAATGAAATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-1782s1c1
Sequence:CCGGCCTATTTATCAGATTTGGGAACTCGAGTTCCCAAATCTGATAAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358764
VALIDATED
RRN3 MISSION shRNA shRNA Plasmid DNA
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000119923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-764s1c1
Sequence:CCGGCCCAACTTTGAGGCGTGAAATCTCGAGATTTCACGCCTCAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358764.1-1266s1c1
Sequence:CCGGGCAAATTATATTGGGAGCTTTCTCGAGAAAGCTCCCAATATAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-3083s1c1
Sequence:CCGGCCTGAATTTCATTCTGTCTATCTCGAGATAGACAGAATGAAATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-1782s1c1
Sequence:CCGGCCTATTTATCAGATTTGGGAACTCGAGTTCCCAAATCTGATAAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358764
VALIDATED
RRN3 MISSION shRNA Lentiviral Transduction Particles
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000119923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-764s1c1
Sequence:CCGGCCCAACTTTGAGGCGTGAAATCTCGAGATTTCACGCCTCAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358764.1-1266s1c1
Sequence:CCGGGCAAATTATATTGGGAGCTTTCTCGAGAAAGCTCCCAATATAATTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-3083s1c1
Sequence:CCGGCCTGAATTTCATTCTGTCTATCTCGAGATAGACAGAATGAAATTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358764.1-1782s1c1
Sequence:CCGGCCTATTTATCAGATTTGGGAACTCGAGTTCCCAAATCTGATAAATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018427
RRN3 MISSION shRNA Bacterial Glycerol Stock
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1055s1c1
Sequence:CCGGCGCGACCTGATAAACATCTTTCTCGAGAAAGATGTTTATCAGGTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1832s1c1
Sequence:CCGGGAAGATGATGACTTTCTGAAACTCGAGTTTCAGAAAGTCATCATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1135s1c1
Sequence:CCGGCTGTAGTTTCAAATTGGGATTCTCGAGAATCCCAATTTGAAACTACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1893s1c1
Sequence:CCGGCAAGCTCCTTTGACACGCATTCTCGAGAATGCGTGTCAAAGGAGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-602s1c1
Sequence:CCGGGCAAGATATGTACCATCGACACTCGAGTGTCGATGGTACATATCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018427.3-1058s21c1
Sequence:CCGGTGTAGATGGTAAGGTTGATAACTCGAGTTATCAACCTTACCATCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018427.3-1909s21c1
Sequence:CCGGCCCAGAATGATACCGTGATTGCTCGAGCAATCACGGTATCATTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018427
RRN3 MISSION shRNA shRNA Plasmid DNA
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1055s1c1
Sequence:CCGGCGCGACCTGATAAACATCTTTCTCGAGAAAGATGTTTATCAGGTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1832s1c1
Sequence:CCGGGAAGATGATGACTTTCTGAAACTCGAGTTTCAGAAAGTCATCATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1135s1c1
Sequence:CCGGCTGTAGTTTCAAATTGGGATTCTCGAGAATCCCAATTTGAAACTACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1893s1c1
Sequence:CCGGCAAGCTCCTTTGACACGCATTCTCGAGAATGCGTGTCAAAGGAGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-602s1c1
Sequence:CCGGGCAAGATATGTACCATCGACACTCGAGTGTCGATGGTACATATCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018427.3-1058s21c1
Sequence:CCGGTGTAGATGGTAAGGTTGATAACTCGAGTTATCAACCTTACCATCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018427.3-1909s21c1
Sequence:CCGGCCCAGAATGATACCGTGATTGCTCGAGCAATCACGGTATCATTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018427
RRN3 MISSION shRNA Lentiviral Transduction Particles
RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1055s1c1
Sequence:CCGGCGCGACCTGATAAACATCTTTCTCGAGAAAGATGTTTATCAGGTCGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1832s1c1
Sequence:CCGGGAAGATGATGACTTTCTGAAACTCGAGTTTCAGAAAGTCATCATCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1135s1c1
Sequence:CCGGCTGTAGTTTCAAATTGGGATTCTCGAGAATCCCAATTTGAAACTACAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-1893s1c1
Sequence:CCGGCAAGCTCCTTTGACACGCATTCTCGAGAATGCGTGTCAAAGGAGCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018427.2-602s1c1
Sequence:CCGGGCAAGATATGTACCATCGACACTCGAGTGTCGATGGTACATATCTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018427.3-1058s21c1
Sequence:CCGGTGTAGATGGTAAGGTTGATAACTCGAGTTATCAACCTTACCATCTACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018427.3-1909s21c1
Sequence:CCGGCCCAGAATGATACCGTGATTGCTCGAGCAATCACGGTATCATTCTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)