EMAIL THIS PAGE TO A FRIEND

RRP12

ribosomal RNA processing 12 homolog (S. cerevisiae)

43 Gene Product Result for
Synonyms: KIAA0690
Gene ID:
Mouse(107094) ribosomal RNA processing 12 homolog (S. cerevisiae)
Rat(679127) ribosomal RNA processing 12 homolog (S. cerevisiae)
Zebrafish(563195) ribosomal RNA processing 12 homolog (S. cerevisiae)
Horse(100061050) ribosomal RNA processing 12 homolog (S. cerevisiae)
domestic cat(101098492) ribosomal RNA processing 12 homolog (S. cerevisiae)
dog(608725) ribosomal RNA processing 12 homolog (S. cerevisiae)
chicken(423845) ribosomal RNA processing 12 homolog (S. cerevisiae)
naked mole-rat(101725094) ribosomal RNA processing 12 homolog (S. cerevisiae)
domestic guinea pig(100715761) ribosomal RNA processing 12 homolog (S. cerevisiae)
cow(528990) ribosomal RNA processing 12 homolog (S. cerevisiae)
sheep(101113549) ribosomal RNA processing 12 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0122 AQUA Peptide EGGGDEPLNFLDP[K] cow, human, mouse, rat pricing
AQ0121 AQUA Peptide VLATQPGPG[R] cow, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015179 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015179 Rosetta Predictions human pricing
XM_001054805 Rosetta Predictions rat pricing
NM_199447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169313 predicted 3559
2 SASI_Hs01_00169314 predicted 1975
3 SASI_Hs01_00169315 predicted 508
4 SASI_Hs01_00169316 predicted 1800
5 SASI_Hs01_00169317 predicted 3009
6 SASI_Hs01_00169318 predicted 896
7 SASI_Hs01_00169319 predicted 1803
8 SASI_Hs01_00169320 predicted 1472
9 SASI_Hs01_00169321 predicted 1197
10 SASI_Hs01_00169322 predicted 2116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277336 predicted 1780
2 SASI_Rn02_00277337 predicted 2536
3 SASI_Rn02_00277338 predicted 2962
4 SASI_Rn02_00277339 predicted 984
5 SASI_Rn02_00277340 predicted 1766
6 SASI_Rn02_00277341 predicted 1422
7 SASI_Rn02_00277342 predicted 3086
8 SASI_Rn02_00277343 predicted 3132
9 SASI_Rn02_00277344 predicted 3031
10 SASI_Rn02_00277345 predicted 3009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034296 predicted 2816
2 SASI_Mm01_00034297 predicted 3005
3 SASI_Mm01_00034300 predicted 1044
4 SASI_Mm01_00034301 predicted 629
5 SASI_Mm01_00034302 predicted 2700
6 SASI_Mm01_00034303 predicted 1826
7 SASI_Mm02_00351465 predicted 4013
8 SASI_Mm01_00034304 predicted 1583
9 SASI_Mm01_00034305 predicted 955
10 SASI_Mm02_00351466 predicted 3826
11 SASI_Mm01_00034298 predicted 3877
12 SASI_Mm01_00034299 predicted 1441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199447
VALIDATED
RRP12 MISSION shRNA Bacterial Glycerol Stock
ribosomal RNA processing 12 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2823s1c1
Sequence:CCGGCCACAGTTAGTTGCAGCATTTCTCGAGAAATGCTGCAACTAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2149s1c1
Sequence:CCGGGCCAATCCTCTTCAACCTGTACTCGAGTACAGGTTGAAGAGGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2624s1c1
Sequence:CCGGGCTGAGCATGAGGAGTTCATACTCGAGTATGAACTCCTCATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2149s21c1
Sequence:CCGGGCCAATCCTCTTCAACCTGTACTCGAGTACAGGTTGAAGAGGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-1185s21c1
Sequence:CCGGAGATCGTCACGGCACTATATGCTCGAGCATATAGTGCCGTGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2624s21c1
Sequence:CCGGGCTGAGCATGAGGAGTTCATACTCGAGTATGAACTCCTCATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-4155s1c1
Sequence:CCGGGCCAACATCTAGGAGTGGAAACTCGAGTTTCCACTCCTAGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2150s1c1
Sequence:CCGGCCAATCCTCTTCAACCTGTATCTCGAGATACAGGTTGAAGAGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199447.2-4012s21c1
Sequence:CCGGTTCTAACTCCCATGATGTTTACTCGAGTAAACATCATGGGAGTTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2823s21c1
Sequence:CCGGCCACAGTTAGTTGCAGCATTTCTCGAGAAATGCTGCAACTAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199447
VALIDATED
RRP12 MISSION shRNA shRNA Plasmid DNA
ribosomal RNA processing 12 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2823s1c1
Sequence:CCGGCCACAGTTAGTTGCAGCATTTCTCGAGAAATGCTGCAACTAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2149s1c1
Sequence:CCGGGCCAATCCTCTTCAACCTGTACTCGAGTACAGGTTGAAGAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2624s1c1
Sequence:CCGGGCTGAGCATGAGGAGTTCATACTCGAGTATGAACTCCTCATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2149s21c1
Sequence:CCGGGCCAATCCTCTTCAACCTGTACTCGAGTACAGGTTGAAGAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-1185s21c1
Sequence:CCGGAGATCGTCACGGCACTATATGCTCGAGCATATAGTGCCGTGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2624s21c1
Sequence:CCGGGCTGAGCATGAGGAGTTCATACTCGAGTATGAACTCCTCATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-4155s1c1
Sequence:CCGGGCCAACATCTAGGAGTGGAAACTCGAGTTTCCACTCCTAGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2150s1c1
Sequence:CCGGCCAATCCTCTTCAACCTGTATCTCGAGATACAGGTTGAAGAGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199447.2-4012s21c1
Sequence:CCGGTTCTAACTCCCATGATGTTTACTCGAGTAAACATCATGGGAGTTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2823s21c1
Sequence:CCGGCCACAGTTAGTTGCAGCATTTCTCGAGAAATGCTGCAACTAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199447
VALIDATED
RRP12 MISSION shRNA Lentiviral Transduction Particles
ribosomal RNA processing 12 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2823s1c1
Sequence:CCGGCCACAGTTAGTTGCAGCATTTCTCGAGAAATGCTGCAACTAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2149s1c1
Sequence:CCGGGCCAATCCTCTTCAACCTGTACTCGAGTACAGGTTGAAGAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2624s1c1
Sequence:CCGGGCTGAGCATGAGGAGTTCATACTCGAGTATGAACTCCTCATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2149s21c1
Sequence:CCGGGCCAATCCTCTTCAACCTGTACTCGAGTACAGGTTGAAGAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-1185s21c1
Sequence:CCGGAGATCGTCACGGCACTATATGCTCGAGCATATAGTGCCGTGACGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2624s21c1
Sequence:CCGGGCTGAGCATGAGGAGTTCATACTCGAGTATGAACTCCTCATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-4155s1c1
Sequence:CCGGGCCAACATCTAGGAGTGGAAACTCGAGTTTCCACTCCTAGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199447.2-2150s1c1
Sequence:CCGGCCAATCCTCTTCAACCTGTATCTCGAGATACAGGTTGAAGAGGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199447.2-4012s21c1
Sequence:CCGGTTCTAACTCCCATGATGTTTACTCGAGTAAACATCATGGGAGTTAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199447.2-2823s21c1
Sequence:CCGGCCACAGTTAGTTGCAGCATTTCTCGAGAAATGCTGCAACTAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015179
VALIDATED
RRP12 MISSION shRNA Bacterial Glycerol Stock
ribosomal RNA processing 12 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2373s1c1
Sequence:CCGGGAAGCTGCCATCAGTAAGCTACTCGAGTAGCTTACTGATGGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-3768s1c1
Sequence:CCGGGCTGAATACAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGTATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2225s1c1
Sequence:CCGGCATCAGAACTTACCTCACCATCTCGAGATGGTGAGGTAAGTTCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2148s1c1
Sequence:CCGGCCGATCCTCTTCAACCTGTATCTCGAGATACAGGTTGAAGAGGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-616s1c1
Sequence:CCGGGCCCTGTGCTTATTAAGAAGTCTCGAGACTTCTTAATAAGCACAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-2287s21c1
Sequence:CCGGCATCAGAACTTACCTCACCATCTCGAGATGGTGAGGTAAGTTCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-1209s1c1
Sequence:CCGGGTTCCCAGTGAGAATGATTTACTCGAGTAAATCATTCTCACTGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2311s1c1
Sequence:CCGGGCTCTGACTTTACCAGATTGTCTCGAGACAATCTGGTAAAGTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015179.2-4082s1c1
Sequence:CCGGGATGACTTGGAACTAGGGCTTCTCGAGAAGCCCTAGTTCCAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015179.2-1202s1c1
Sequence:CCGGCGACTATGTTCCCAGTGAGAACTCGAGTTCTCACTGGGAACATAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015179.3-4144s21c1
Sequence:CCGGGATGACTTGGAACTAGGGCTTCTCGAGAAGCCCTAGTTCCAAGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-1264s21c1
Sequence:CCGGCGACTATGTTCCCAGTGAGAACTCGAGTTCTCACTGGGAACATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-678s21c1
Sequence:CCGGGCCCTGTGCTTATTAAGAAGTCTCGAGACTTCTTAATAAGCACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015179
VALIDATED
RRP12 MISSION shRNA shRNA Plasmid DNA
ribosomal RNA processing 12 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2373s1c1
Sequence:CCGGGAAGCTGCCATCAGTAAGCTACTCGAGTAGCTTACTGATGGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-3768s1c1
Sequence:CCGGGCTGAATACAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGTATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2225s1c1
Sequence:CCGGCATCAGAACTTACCTCACCATCTCGAGATGGTGAGGTAAGTTCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2148s1c1
Sequence:CCGGCCGATCCTCTTCAACCTGTATCTCGAGATACAGGTTGAAGAGGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-616s1c1
Sequence:CCGGGCCCTGTGCTTATTAAGAAGTCTCGAGACTTCTTAATAAGCACAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-2287s21c1
Sequence:CCGGCATCAGAACTTACCTCACCATCTCGAGATGGTGAGGTAAGTTCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-1209s1c1
Sequence:CCGGGTTCCCAGTGAGAATGATTTACTCGAGTAAATCATTCTCACTGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2311s1c1
Sequence:CCGGGCTCTGACTTTACCAGATTGTCTCGAGACAATCTGGTAAAGTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015179.2-4082s1c1
Sequence:CCGGGATGACTTGGAACTAGGGCTTCTCGAGAAGCCCTAGTTCCAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015179.2-1202s1c1
Sequence:CCGGCGACTATGTTCCCAGTGAGAACTCGAGTTCTCACTGGGAACATAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015179.3-4144s21c1
Sequence:CCGGGATGACTTGGAACTAGGGCTTCTCGAGAAGCCCTAGTTCCAAGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-1264s21c1
Sequence:CCGGCGACTATGTTCCCAGTGAGAACTCGAGTTCTCACTGGGAACATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-678s21c1
Sequence:CCGGGCCCTGTGCTTATTAAGAAGTCTCGAGACTTCTTAATAAGCACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015179
VALIDATED
RRP12 MISSION shRNA Lentiviral Transduction Particles
ribosomal RNA processing 12 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2373s1c1
Sequence:CCGGGAAGCTGCCATCAGTAAGCTACTCGAGTAGCTTACTGATGGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-3768s1c1
Sequence:CCGGGCTGAATACAAGGCCAAGAAACTCGAGTTTCTTGGCCTTGTATTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2225s1c1
Sequence:CCGGCATCAGAACTTACCTCACCATCTCGAGATGGTGAGGTAAGTTCTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2148s1c1
Sequence:CCGGCCGATCCTCTTCAACCTGTATCTCGAGATACAGGTTGAAGAGGATCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-616s1c1
Sequence:CCGGGCCCTGTGCTTATTAAGAAGTCTCGAGACTTCTTAATAAGCACAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-2287s21c1
Sequence:CCGGCATCAGAACTTACCTCACCATCTCGAGATGGTGAGGTAAGTTCTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-1209s1c1
Sequence:CCGGGTTCCCAGTGAGAATGATTTACTCGAGTAAATCATTCTCACTGGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015179.2-2311s1c1
Sequence:CCGGGCTCTGACTTTACCAGATTGTCTCGAGACAATCTGGTAAAGTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015179.2-4082s1c1
Sequence:CCGGGATGACTTGGAACTAGGGCTTCTCGAGAAGCCCTAGTTCCAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015179.2-1202s1c1
Sequence:CCGGCGACTATGTTCCCAGTGAGAACTCGAGTTCTCACTGGGAACATAGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015179.3-4144s21c1
Sequence:CCGGGATGACTTGGAACTAGGGCTTCTCGAGAAGCCCTAGTTCCAAGTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-1264s21c1
Sequence:CCGGCGACTATGTTCCCAGTGAGAACTCGAGTTCTCACTGGGAACATAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015179.3-678s21c1
Sequence:CCGGGCCCTGTGCTTATTAAGAAGTCTCGAGACTTCTTAATAAGCACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)