EMAIL THIS PAGE TO A FRIEND

RS1

retinoschisin 1

40 Gene Product Result for
Synonyms: RS XLRS1
UniProtKB ID: O15537
Gene ID:
Human(6247) Summary: This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]
Mouse(20147) retinoschisis (X-linked, juvenile) 1 (human)
Rat(100125595) retinoschisin 1
fruit fly(44087) CG2173 gene product from transcript CG2173-RA
domestic cat(101088816) retinoschisin 1
dog(491762) retinoschisin 1
chicken(772315) retinoschisin 1
Zebrafish(445044) retinoschisis (X-linked, juvenile) 1
cow(615193) retinoschisin 1
sheep(101104127) retinoschisin 1
naked mole-rat(101701819) retinoschisin 1
Domestic Rabbit(100126075) retinoschisin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000330 Rosetta Predictions human pricing
NM_001104643 Rosetta Predictions rat pricing
NM_011302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036746 predicted 285
2 SASI_Hs01_00036747 predicted 1095
3 SASI_Hs01_00036749 predicted 211
4 SASI_Hs01_00036750 predicted 481
5 SASI_Hs01_00036751 predicted 340
6 SASI_Hs01_00036752 predicted 206
7 SASI_Hs01_00036753 predicted 388
8 SASI_Hs02_00302344 predicted 312
9 SASI_Hs01_00036754 predicted 395
10 SASI_Hs01_00036755 predicted 549
11 SASI_Hs01_00036748 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211716 predicted 253
2 SASI_Rn02_00211717 predicted 292
3 SASI_Rn02_00211718 predicted 364
4 SASI_Rn02_00211719 predicted 347
5 SASI_Rn02_00211720 predicted 321
6 SASI_Rn02_00211721 predicted 446
7 SASI_Rn02_00211722 predicted 408
8 SASI_Rn02_00211723 predicted 317
9 SASI_Rn02_00211724 predicted 347
10 SASI_Rn02_00211725 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159607 predicted 649
2 SASI_Mm01_00159608 predicted 432
3 SASI_Mm01_00159609 predicted 531
4 SASI_Mm01_00159610 predicted 470
5 SASI_Mm01_00159611 predicted 611
6 SASI_Mm01_00159612 predicted 625
7 SASI_Mm01_00159613 predicted 707
8 SASI_Mm01_00159614 predicted 683
9 SASI_Mm01_00159615 predicted 341
10 SASI_Mm01_00159616 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011302
RS1 MISSION shRNA Bacterial Glycerol Stock
retinoschisin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011302.3-2780s1c1
Sequence:CCGGGCTCATTTAATCAGGAGCTTTCTCGAGAAAGCTCCTGATTAAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-650s1c1
Sequence:CCGGGCGCCTGAACTGGATCTACTACTCGAGTAGTAGATCCAGTTCAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-333s1c1
Sequence:CCGGGCTACCTCCTTAGACTGTATTCTCGAGAATACAGTCTAAGGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-716s1c1
Sequence:CCGGCCGGAGTTCTACAGTTCAGAACTCGAGTTCTGAACTGTAGAACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-476s1c1
Sequence:CCGGCCGACTCAACAGTCAAGGTTTCTCGAGAAACCTTGACTGTTGAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011302
RS1 MISSION shRNA shRNA Plasmid DNA
retinoschisin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011302.3-2780s1c1
Sequence:CCGGGCTCATTTAATCAGGAGCTTTCTCGAGAAAGCTCCTGATTAAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-650s1c1
Sequence:CCGGGCGCCTGAACTGGATCTACTACTCGAGTAGTAGATCCAGTTCAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-333s1c1
Sequence:CCGGGCTACCTCCTTAGACTGTATTCTCGAGAATACAGTCTAAGGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-716s1c1
Sequence:CCGGCCGGAGTTCTACAGTTCAGAACTCGAGTTCTGAACTGTAGAACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-476s1c1
Sequence:CCGGCCGACTCAACAGTCAAGGTTTCTCGAGAAACCTTGACTGTTGAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011302
RS1 MISSION shRNA Lentiviral Transduction Particles
retinoschisin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011302.3-2780s1c1
Sequence:CCGGGCTCATTTAATCAGGAGCTTTCTCGAGAAAGCTCCTGATTAAATGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-650s1c1
Sequence:CCGGGCGCCTGAACTGGATCTACTACTCGAGTAGTAGATCCAGTTCAGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-333s1c1
Sequence:CCGGGCTACCTCCTTAGACTGTATTCTCGAGAATACAGTCTAAGGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-716s1c1
Sequence:CCGGCCGGAGTTCTACAGTTCAGAACTCGAGTTCTGAACTGTAGAACTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011302.3-476s1c1
Sequence:CCGGCCGACTCAACAGTCAAGGTTTCTCGAGAAACCTTGACTGTTGAGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000330
RS1 MISSION shRNA Bacterial Glycerol Stock
retinoschisin 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-182s1c1
Sequence:CCGGCCTTGGACTGTATACCAGAATCTCGAGATTCTGGTATACAGTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-492s1c1
Sequence:CCGGGCGCCTGAACTGGATTTACTACTCGAGTAGTAAATCCAGTTCAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-447s1c1
Sequence:CCGGCGATGAGTGGATGACCAAGTACTCGAGTACTTGGTCATCCACTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-319s1c1
Sequence:CCGGCGGCTCAACAGTCAAGGCTTTCTCGAGAAAGCCTTGACTGTTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000330.3-1067s21c1
Sequence:CCGGTTCATTTGCTTTACCACATTCCTCGAGGAATGTGGTAAAGCAAATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000330.3-82s21c1
Sequence:CCGGATGAAGCCACATTGGGATTATCTCGAGATAATCCCAATGTGGCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000330
RS1 MISSION shRNA shRNA Plasmid DNA
retinoschisin 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-182s1c1
Sequence:CCGGCCTTGGACTGTATACCAGAATCTCGAGATTCTGGTATACAGTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-492s1c1
Sequence:CCGGGCGCCTGAACTGGATTTACTACTCGAGTAGTAAATCCAGTTCAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-447s1c1
Sequence:CCGGCGATGAGTGGATGACCAAGTACTCGAGTACTTGGTCATCCACTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-319s1c1
Sequence:CCGGCGGCTCAACAGTCAAGGCTTTCTCGAGAAAGCCTTGACTGTTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000330.3-1067s21c1
Sequence:CCGGTTCATTTGCTTTACCACATTCCTCGAGGAATGTGGTAAAGCAAATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000330.3-82s21c1
Sequence:CCGGATGAAGCCACATTGGGATTATCTCGAGATAATCCCAATGTGGCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000330
RS1 MISSION shRNA Lentiviral Transduction Particles
retinoschisin 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-182s1c1
Sequence:CCGGCCTTGGACTGTATACCAGAATCTCGAGATTCTGGTATACAGTCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-492s1c1
Sequence:CCGGGCGCCTGAACTGGATTTACTACTCGAGTAGTAAATCCAGTTCAGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-447s1c1
Sequence:CCGGCGATGAGTGGATGACCAAGTACTCGAGTACTTGGTCATCCACTCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000330.1-319s1c1
Sequence:CCGGCGGCTCAACAGTCAAGGCTTTCTCGAGAAAGCCTTGACTGTTGAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000330.3-1067s21c1
Sequence:CCGGTTCATTTGCTTTACCACATTCCTCGAGGAATGTGGTAAAGCAAATGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000330.3-82s21c1
Sequence:CCGGATGAAGCCACATTGGGATTATCTCGAGATAATCCCAATGTGGCTTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)