EMAIL THIS PAGE TO A FRIEND

RSPO3

R-spondin 3

133 Gene Product Result for
Synonyms: CRISTIN1 PWTSR THSD2
UniProtKB ID: Q9BXY4, B2RC27, Q5VTV4, Q96K87
Gene ID:
Human(84870) Summary: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. [provided by RefSeq, Jul 2013]
Mouse(72780) R-spondin 3 homolog (Xenopus laevis)
Rat(498997) R-spondin 3
Zebrafish(100007702) R-spondin 3 homolog (Xenopus laevis)
chicken(421715) R-spondin 3
Horse(100067377) R-spondin 3
dog(476287) R-spondin 3
cow(534650) R-spondin 3
sheep(101116995) R-spondin 3
Goat(100860772) R-spondin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032784 Rosetta Predictions human pricing
NM_001100990 Rosetta Predictions rat pricing
NM_028351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012894 predicted 1199
2 SASI_Hs01_00012895 predicted 544
3 SASI_Hs01_00012896 predicted 695
4 SASI_Hs01_00012897 predicted 1337
5 SASI_Hs01_00012898 predicted 449
6 SASI_Hs01_00012899 predicted 644
7 SASI_Hs01_00012901 predicted 687
8 SASI_Hs01_00012902 predicted 1245
9 SASI_Hs01_00012903 predicted 500
10 SASI_Hs02_00360338 predicted 590
11 SASI_Hs01_00012900 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211042 predicted 782
2 SASI_Rn02_00211043 predicted 470
3 SASI_Rn02_00211044 predicted 352
4 SASI_Rn02_00211045 predicted 328
5 SASI_Rn02_00211046 predicted 601
6 SASI_Rn02_00211047 predicted 298
7 SASI_Rn02_00211048 predicted 335
8 SASI_Rn02_00211049 predicted 505
9 SASI_Rn02_00211050 predicted 326
10 SASI_Rn02_00211051 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136417 predicted 1598
2 SASI_Mm01_00136418 predicted 695
3 SASI_Mm02_00333722 predicted 748
4 SASI_Mm01_00136420 predicted 1580
5 SASI_Mm01_00136422 predicted 903
6 SASI_Mm01_00136423 predicted 1464
7 SASI_Mm01_00136424 predicted 1422
8 SASI_Mm01_00136425 predicted 1437
9 SASI_Mm02_00333723 predicted 1421
10 SASI_Mm02_00333724 predicted 883
11 SASI_Mm01_00136419 predicted 1523
12 SASI_Mm01_00136421 predicted 906
13 SASI_Mm01_00136426 predicted 1500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032784
VALIDATED
RSPO3 MISSION shRNA Bacterial Glycerol Stock
R-spondin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-1228s21c1
Sequence:CCGGACATTCCCAGTAGTTGCTATACTCGAGTATAGCAACTACTGGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-456s21c1
Sequence:CCGGTCATGTAAGCCCAGACTATTTCTCGAGAAATAGTCTGGGCTTACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-1250s21c1
Sequence:CCGGTCTTCATACAAGCATAGTTAACTCGAGTTAACTATGCTTGTATGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-413s1c1
Sequence:CCGGGCTGTGCAACATGCTCAGATTCTCGAGAATCTGAGCATGTTGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032784.2-369s1c1
Sequence:CCGGCCAGCGAAGAATGCATCCTAACTCGAGTTAGGATGCATTCTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-825s1c1
Sequence:CCGGGCATCCTTCAGCAAAGGGTAACTCGAGTTACCCTTTGCTGAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032784.2-855s1c1
Sequence:CCGGCCCAACAAATGAGACAAGAAACTCGAGTTTCTTGTCTCATTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-645s1c1
Sequence:CCGGCCTTGGAAAGTGCCTTGACAACTCGAGTTGTCAAGGCACTTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032784
VALIDATED
RSPO3 MISSION shRNA shRNA Plasmid DNA
R-spondin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-1228s21c1
Sequence:CCGGACATTCCCAGTAGTTGCTATACTCGAGTATAGCAACTACTGGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-456s21c1
Sequence:CCGGTCATGTAAGCCCAGACTATTTCTCGAGAAATAGTCTGGGCTTACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-1250s21c1
Sequence:CCGGTCTTCATACAAGCATAGTTAACTCGAGTTAACTATGCTTGTATGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-413s1c1
Sequence:CCGGGCTGTGCAACATGCTCAGATTCTCGAGAATCTGAGCATGTTGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032784.2-369s1c1
Sequence:CCGGCCAGCGAAGAATGCATCCTAACTCGAGTTAGGATGCATTCTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-825s1c1
Sequence:CCGGGCATCCTTCAGCAAAGGGTAACTCGAGTTACCCTTTGCTGAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032784.2-855s1c1
Sequence:CCGGCCCAACAAATGAGACAAGAAACTCGAGTTTCTTGTCTCATTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-645s1c1
Sequence:CCGGCCTTGGAAAGTGCCTTGACAACTCGAGTTGTCAAGGCACTTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032784
VALIDATED
RSPO3 MISSION shRNA Lentiviral Transduction Particles
R-spondin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-1228s21c1
Sequence:CCGGACATTCCCAGTAGTTGCTATACTCGAGTATAGCAACTACTGGGAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-456s21c1
Sequence:CCGGTCATGTAAGCCCAGACTATTTCTCGAGAAATAGTCTGGGCTTACATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032784.3-1250s21c1
Sequence:CCGGTCTTCATACAAGCATAGTTAACTCGAGTTAACTATGCTTGTATGAAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-413s1c1
Sequence:CCGGGCTGTGCAACATGCTCAGATTCTCGAGAATCTGAGCATGTTGCACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032784.2-369s1c1
Sequence:CCGGCCAGCGAAGAATGCATCCTAACTCGAGTTAGGATGCATTCTTCGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-825s1c1
Sequence:CCGGGCATCCTTCAGCAAAGGGTAACTCGAGTTACCCTTTGCTGAAGGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032784.2-855s1c1
Sequence:CCGGCCCAACAAATGAGACAAGAAACTCGAGTTTCTTGTCTCATTTGTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000056664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032784.2-645s1c1
Sequence:CCGGCCTTGGAAAGTGCCTTGACAACTCGAGTTGTCAAGGCACTTTCCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028351
RSPO3 MISSION shRNA Bacterial Glycerol Stock
R-spondin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028351.1-2678s1c1
Sequence:CCGGCCTCAGTCTATCGCTCTCTATCTCGAGATAGAGAGCGATAGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-1066s1c1
Sequence:CCGGCAGCGAGACAAGAACTTGTATCTCGAGATACAAGTTCTTGTCTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-621s1c1
Sequence:CCGGTGCAACGTGTTCAGATTACAACTCGAGTTGTAATCTGAACACGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-1069s1c1
Sequence:CCGGCGAGACAAGAACTTGTATAGTCTCGAGACTATACAAGTTCTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-890s1c1
Sequence:CCGGCCAACAATCATACTATGGAATCTCGAGATTCCATAGTATGATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028351
RSPO3 MISSION shRNA shRNA Plasmid DNA
R-spondin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028351.1-2678s1c1
Sequence:CCGGCCTCAGTCTATCGCTCTCTATCTCGAGATAGAGAGCGATAGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-1066s1c1
Sequence:CCGGCAGCGAGACAAGAACTTGTATCTCGAGATACAAGTTCTTGTCTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-621s1c1
Sequence:CCGGTGCAACGTGTTCAGATTACAACTCGAGTTGTAATCTGAACACGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-1069s1c1
Sequence:CCGGCGAGACAAGAACTTGTATAGTCTCGAGACTATACAAGTTCTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-890s1c1
Sequence:CCGGCCAACAATCATACTATGGAATCTCGAGATTCCATAGTATGATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028351
RSPO3 MISSION shRNA Lentiviral Transduction Particles
R-spondin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028351.1-2678s1c1
Sequence:CCGGCCTCAGTCTATCGCTCTCTATCTCGAGATAGAGAGCGATAGACTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-1066s1c1
Sequence:CCGGCAGCGAGACAAGAACTTGTATCTCGAGATACAAGTTCTTGTCTCGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-621s1c1
Sequence:CCGGTGCAACGTGTTCAGATTACAACTCGAGTTGTAATCTGAACACGTTGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-1069s1c1
Sequence:CCGGCGAGACAAGAACTTGTATAGTCTCGAGACTATACAAGTTCTTGTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028351.1-890s1c1
Sequence:CCGGCCAACAATCATACTATGGAATCTCGAGATTCCATAGTATGATTGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???