EMAIL THIS PAGE TO A FRIEND

RSPO4

R-spondin 4

101 Gene Product Result for
Synonyms: C20orf182 CRISTIN4
UniProtKB ID: Q2I0M5, A2A2I6, Q9UGB2
Gene ID:
Human(343637) Summary: This gene encodes a member of the R-spondin family of proteins that share a common domain organization consisting of a signal peptide, cysteine-rich/furin-like domain, thrombospondin domain and a C-terminal basic region. The encoded protein may be involved in activation of Wnt/beta-catenin signaling pathways. Mutations in this gene are associated with anonychia congenital. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
Mouse(228770) R-spondin family, member 4
Rat(499918) R-spondin 4
cow(517783) R-spondin 4
sheep(101107213) R-spondin 4
Goat(100860773) R-spondin 4
chicken(428155) R-spondin 4
dog(485813) R-spondin 4
Horse(100067769) R-spondin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029871 Rosetta Predictions human pricing
NM_001040007 Rosetta Predictions human pricing
XM_575261 Rosetta Predictions rat pricing
XR_009508 Rosetta Predictions rat pricing
NM_001040689 Rosetta Predictions mouse pricing
NM_175468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197570 predicted 282
2 SASI_Hs01_00197571 predicted 268
3 SASI_Hs02_00307548 predicted 275
4 SASI_Hs02_00307549 predicted 245
5 SASI_Hs01_00197572 predicted 463
6 SASI_Hs01_00197573 predicted 1249
7 SASI_Hs02_00307550 predicted 1183
8 SASI_Hs01_00197575 predicted 1177
9 SASI_Hs01_00197576 predicted 1284
10 SASI_Hs01_00197578 predicted 639
11 SASI_Hs01_00197574 predicted 1200
12 SASI_Hs01_00197577 predicted 378
13 SASI_Hs01_00197579 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222811 predicted 287
2 SASI_Hs01_00222812 predicted 266
3 SASI_Hs02_00308748 predicted 464
4 SASI_Hs01_00222814 predicted 1069
5 SASI_Hs01_00222815 predicted 1100
6 SASI_Hs01_00222817 predicted 2058
7 SASI_Hs01_00222818 predicted 2432
8 SASI_Hs01_00222819 predicted 1998
9 SASI_Hs01_00222820 predicted 1503
10 SASI_Hs02_00308749 predicted 2009
11 SASI_Hs01_00222813 predicted 280
12 SASI_Hs01_00222816 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403400 predicted 369
2 SASI_Rn02_00403401 predicted 611
3 SASI_Rn02_00403402 predicted 650
4 SASI_Rn02_00403403 predicted 512
5 SASI_Rn02_00403404 predicted 526
6 SASI_Rn02_00403405 predicted 698
7 SASI_Rn02_00403406 predicted 511
8 SASI_Rn02_00403407 predicted 650
9 SASI_Rn02_00403408 predicted 321
10 SASI_Rn02_00403409 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419979 predicted 264
2 SASI_Rn01_00177563 predicted 223
3 SASI_Rn02_00419980 predicted 263
4 SASI_Rn02_00419981 predicted 235
5 SASI_Rn01_00177566 predicted 314
6 SASI_Rn02_00419982 predicted 260
7 SASI_Rn02_00419983 predicted 271
8 SASI_Rn02_00419984 predicted 219
9 SASI_Rn02_00419985 predicted 283
10 SASI_Rn02_00419986 predicted 229
11 SASI_Rn01_00177557 predicted 441
12 SASI_Rn01_00177558 predicted 456
13 SASI_Rn01_00177559 predicted 453
14 SASI_Rn01_00177560 predicted 621
15 SASI_Rn01_00177561 predicted 471
16 SASI_Rn01_00177562 predicted 636
17 SASI_Rn01_00177564 predicted 132
18 SASI_Rn01_00177565 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290336 predicted 717
2 SASI_Mm02_00290337 predicted 469
3 SASI_Mm02_00290338 predicted 330
4 SASI_Mm02_00290339 predicted 516
5 SASI_Mm02_00290340 predicted 673
6 SASI_Mm02_00290341 predicted 783
7 SASI_Mm02_00290342 predicted 430
8 SASI_Mm02_00290343 predicted 809
9 SASI_Mm02_00290344 predicted 682
10 SASI_Mm02_00290345 predicted 584
11 SASI_Mm01_00126233 predicted 261
12 SASI_Mm01_00126234 predicted 256
13 SASI_Mm01_00126235 predicted 207
14 SASI_Mm01_00126236 predicted 201
15 SASI_Mm01_00126237 predicted 284
16 SASI_Mm01_00126238 predicted 248
17 SASI_Mm01_00126239 predicted 247
18 SASI_Mm01_00126240 predicted 245
19 SASI_Mm01_00126241 predicted 265
20 SASI_Mm01_00126242 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143900 predicted 265
2 SASI_Mm01_00143901 predicted 254
3 SASI_Mm01_00143902 predicted 198
4 SASI_Mm01_00143903 predicted 199
5 SASI_Mm01_00143904 predicted 200
6 SASI_Mm01_00143905 predicted 286
7 SASI_Mm01_00143906 predicted 244
8 SASI_Mm01_00143907 predicted 247
9 SASI_Mm01_00143908 predicted 253
10 SASI_Mm01_00143909 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040689
RSPO4 MISSION shRNA Bacterial Glycerol Stock
R-spondin 4
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000417647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040689.1-1293s21c1
Sequence:CCGGACCCTGCAGCCGGAGTTATATCTCGAGATATAACTCCGGCTGCAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040689.1-1210s21c1
Sequence:CCGGCATCTTTGCAAAGTTACAATTCTCGAGAATTGTAACTTTGCAAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040689
RSPO4 MISSION shRNA shRNA Plasmid DNA
R-spondin 4
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000417647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040689.1-1293s21c1
Sequence:CCGGACCCTGCAGCCGGAGTTATATCTCGAGATATAACTCCGGCTGCAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040689.1-1210s21c1
Sequence:CCGGCATCTTTGCAAAGTTACAATTCTCGAGAATTGTAACTTTGCAAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040689
RSPO4 MISSION shRNA Lentiviral Transduction Particles
R-spondin 4
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000417647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040689.1-1293s21c1
Sequence:CCGGACCCTGCAGCCGGAGTTATATCTCGAGATATAACTCCGGCTGCAGGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040689.1-1210s21c1
Sequence:CCGGCATCTTTGCAAAGTTACAATTCTCGAGAATTGTAACTTTGCAAAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175468
RSPO4 MISSION shRNA Bacterial Glycerol Stock
R-spondin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175468.2-1010s1c1
Sequence:CCGGCCTGTCCTTCTTTGAAACTTTCTCGAGAAAGTTTCAAAGAAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-452s1c1
Sequence:CCGGGACTTCTGTATCCGCTGCAAACTCGAGTTTGCAGCGGATACAGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-202s1c1
Sequence:CCGGCGCCCTGTACCGAAGGAAGAACTCGAGTTCTTCCTTCGGTACAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-337s1c1
Sequence:CCGGCCGTCAGTACGGCAAGTGTGTCTCGAGACACACTTGCCGTACTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-473s1c1
Sequence:CCGGAGGCGGTTTCACCTATACAAACTCGAGTTTGTATAGGTGAAACCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175468
RSPO4 MISSION shRNA shRNA Plasmid DNA
R-spondin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175468.2-1010s1c1
Sequence:CCGGCCTGTCCTTCTTTGAAACTTTCTCGAGAAAGTTTCAAAGAAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-452s1c1
Sequence:CCGGGACTTCTGTATCCGCTGCAAACTCGAGTTTGCAGCGGATACAGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-202s1c1
Sequence:CCGGCGCCCTGTACCGAAGGAAGAACTCGAGTTCTTCCTTCGGTACAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-337s1c1
Sequence:CCGGCCGTCAGTACGGCAAGTGTGTCTCGAGACACACTTGCCGTACTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-473s1c1
Sequence:CCGGAGGCGGTTTCACCTATACAAACTCGAGTTTGTATAGGTGAAACCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175468
RSPO4 MISSION shRNA Lentiviral Transduction Particles
R-spondin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175468.2-1010s1c1
Sequence:CCGGCCTGTCCTTCTTTGAAACTTTCTCGAGAAAGTTTCAAAGAAGGACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-452s1c1
Sequence:CCGGGACTTCTGTATCCGCTGCAAACTCGAGTTTGCAGCGGATACAGAAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-202s1c1
Sequence:CCGGCGCCCTGTACCGAAGGAAGAACTCGAGTTCTTCCTTCGGTACAGGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-337s1c1
Sequence:CCGGCCGTCAGTACGGCAAGTGTGTCTCGAGACACACTTGCCGTACTGACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175468.2-473s1c1
Sequence:CCGGAGGCGGTTTCACCTATACAAACTCGAGTTTGTATAGGTGAAACCGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029871
RSPO4 MISSION shRNA Bacterial Glycerol Stock
R-spondin 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2633s1c1
Sequence:CCGGCCTCAGAAACGGGATTTGTATCTCGAGATACAAATCCCGTTTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2053s1c1
Sequence:CCGGGCCACTGAAACGGAAAGGAAACTCGAGTTTCCTTTCCGTTTCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-576s1c1
Sequence:CCGGCAACTGCACAGGCTGTATCATCTCGAGATGATACAGCCTGTGCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-99s1c1
Sequence:CCGGGAAGGAGGAACAGACAGAGAACTCGAGTTCTCTGTCTGTTCCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-1037s1c1
Sequence:CCGGCAAGGAAATGTCCCATCCAGACTCGAGTCTGGATGGGACATTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-926s1c1
Sequence:CCGGGCACACACAATGGAAAGACCTCTCGAGAGGTCTTTCCATTGTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-537s1c1
Sequence:CCGGGAACCGAAGGAAGAAGCAAGTCTCGAGACTTGCTTCTTCCTTCGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-1462s1c1
Sequence:CCGGCCTGTGTTTCTTCCTGTCCTTCTCGAGAAGGACAGGAAGAAACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-535s1c1
Sequence:CCGGCTGAACCGAAGGAAGAAGCAACTCGAGTTGCTTCTTCCTTCGGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-72s1c1
Sequence:CCGGGAGACAAGGAGTTGTCCTTAACTCGAGTTAAGGACAACTCCTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2063s1c1
Sequence:CCGGCGGAAAGGAAAGCTGAGATTACTCGAGTAATCTCAGCTTTCCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-64s1c1
Sequence:CCGGGAAAGCAGGAGACAAGGAGTTCTCGAGAACTCCTTGTCTCCTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029871
RSPO4 MISSION shRNA shRNA Plasmid DNA
R-spondin 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2633s1c1
Sequence:CCGGCCTCAGAAACGGGATTTGTATCTCGAGATACAAATCCCGTTTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2053s1c1
Sequence:CCGGGCCACTGAAACGGAAAGGAAACTCGAGTTTCCTTTCCGTTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-576s1c1
Sequence:CCGGCAACTGCACAGGCTGTATCATCTCGAGATGATACAGCCTGTGCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-99s1c1
Sequence:CCGGGAAGGAGGAACAGACAGAGAACTCGAGTTCTCTGTCTGTTCCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-1037s1c1
Sequence:CCGGCAAGGAAATGTCCCATCCAGACTCGAGTCTGGATGGGACATTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-926s1c1
Sequence:CCGGGCACACACAATGGAAAGACCTCTCGAGAGGTCTTTCCATTGTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-537s1c1
Sequence:CCGGGAACCGAAGGAAGAAGCAAGTCTCGAGACTTGCTTCTTCCTTCGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-1462s1c1
Sequence:CCGGCCTGTGTTTCTTCCTGTCCTTCTCGAGAAGGACAGGAAGAAACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-535s1c1
Sequence:CCGGCTGAACCGAAGGAAGAAGCAACTCGAGTTGCTTCTTCCTTCGGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-72s1c1
Sequence:CCGGGAGACAAGGAGTTGTCCTTAACTCGAGTTAAGGACAACTCCTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2063s1c1
Sequence:CCGGCGGAAAGGAAAGCTGAGATTACTCGAGTAATCTCAGCTTTCCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-64s1c1
Sequence:CCGGGAAAGCAGGAGACAAGGAGTTCTCGAGAACTCCTTGTCTCCTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029871
RSPO4 MISSION shRNA Lentiviral Transduction Particles
R-spondin 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2633s1c1
Sequence:CCGGCCTCAGAAACGGGATTTGTATCTCGAGATACAAATCCCGTTTCTGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2053s1c1
Sequence:CCGGGCCACTGAAACGGAAAGGAAACTCGAGTTTCCTTTCCGTTTCAGTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-576s1c1
Sequence:CCGGCAACTGCACAGGCTGTATCATCTCGAGATGATACAGCCTGTGCAGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-99s1c1
Sequence:CCGGGAAGGAGGAACAGACAGAGAACTCGAGTTCTCTGTCTGTTCCTCCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-1037s1c1
Sequence:CCGGCAAGGAAATGTCCCATCCAGACTCGAGTCTGGATGGGACATTTCCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-926s1c1
Sequence:CCGGGCACACACAATGGAAAGACCTCTCGAGAGGTCTTTCCATTGTGTGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-537s1c1
Sequence:CCGGGAACCGAAGGAAGAAGCAAGTCTCGAGACTTGCTTCTTCCTTCGGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-1462s1c1
Sequence:CCGGCCTGTGTTTCTTCCTGTCCTTCTCGAGAAGGACAGGAAGAAACACAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-535s1c1
Sequence:CCGGCTGAACCGAAGGAAGAAGCAACTCGAGTTGCTTCTTCCTTCGGTTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-72s1c1
Sequence:CCGGGAGACAAGGAGTTGTCCTTAACTCGAGTTAAGGACAACTCCTTGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029871.1-2063s1c1
Sequence:CCGGCGGAAAGGAAAGCTGAGATTACTCGAGTAATCTCAGCTTTCCTTTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029871.1-64s1c1
Sequence:CCGGGAAAGCAGGAGACAAGGAGTTCTCGAGAACTCCTTGTCTCCTGCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???