EMAIL THIS PAGE TO A FRIEND

RUFY3

RUN and FYVE domain containing 3

72 Gene Product Result for
Synonyms: RIPX SINGAR1
UniProtKB ID: Q7L099, B3KM25, B4DYW7, D9N163, O94948, Q9UI00
Gene ID:
Mouse(52822) RUN and FYVE domain containing 3
Rat(360921) RUN and FYVE domain containing 3
cow(514798) RUN and FYVE domain containing 3
sheep(101122279) RUN and FYVE domain containing 3
naked mole-rat(101718698) RUN and FYVE domain containing 3
Domestic Rabbit(100356993) RUN and FYVE domain containing 3
domestic guinea pig(100731729) RUN and FYVE domain containing 3
Zebrafish(541522) RUN and FYVE domain containing 3
Horse(100049913) RUN and FYVE domain containing 3
domestic cat(101084623) RUN and FYVE domain containing 3
dog(475168) RUN and FYVE domain containing 3
chicken(422645) RUN and FYVE domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037442 Rosetta Predictions human pricing
NM_014961 Rosetta Predictions human pricing
NM_001025127 Rosetta Predictions rat pricing
XM_001073390 Rosetta Predictions rat pricing
NM_027530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308292 predicted 1220
2 SASI_Hs01_00146952 predicted 1376
3 SASI_Hs02_00308293 predicted 867
4 SASI_Hs01_00146954 predicted 1390
5 SASI_Hs02_00308294 predicted 1192
6 SASI_Hs02_00308295 predicted 1236
7 SASI_Hs02_00308296 predicted 1391
8 SASI_Hs02_00308297 predicted 1346
9 SASI_Hs01_00146960 predicted 757
10 SASI_Hs01_00146961 predicted 1485
11 SASI_Hs01_00146953 predicted 1265
12 SASI_Hs01_00146955 predicted 1362
13 SASI_Hs01_00146956 predicted 1687
14 SASI_Hs01_00146957 predicted 1315
15 SASI_Hs01_00146958 predicted 1347
16 SASI_Hs01_00146959 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042782 predicted 1396
2 SASI_Hs01_00042783 predicted 1281
3 SASI_Hs01_00042784 predicted 1410
4 SASI_Hs01_00042785 predicted 1380
5 SASI_Hs01_00042786 predicted 1705
6 SASI_Hs01_00042787 predicted 1324
7 SASI_Hs02_00346651 predicted 1405
8 SASI_Hs02_00346652 predicted 1368
9 SASI_Hs01_00042789 predicted 1615
10 SASI_Hs01_00042790 predicted 774
11 SASI_Hs01_00042788 predicted 1362
12 SASI_Hs01_00042791 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054231 predicted 682
2 SASI_Rn01_00054233 predicted 1510
3 SASI_Rn01_00054234 predicted 1045
4 SASI_Rn01_00054236 predicted 1366
5 SASI_Rn01_00054237 predicted 969
6 SASI_Rn01_00054238 predicted 1359
7 SASI_Rn01_00054239 predicted 1260
8 SASI_Rn01_00054240 predicted 1008
9 SASI_Rn02_00203046 predicted 1320
10 SASI_Rn02_00203047 predicted 1279
11 SASI_Rn01_00054232 predicted 524
12 SASI_Rn01_00054235 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342645 predicted 380
2 SASI_Rn02_00342646 predicted 1376
3 SASI_Rn02_00342647 predicted 1212
4 SASI_Rn02_00342648 predicted 709
5 SASI_Rn02_00342649 predicted 1072
6 SASI_Rn02_00342650 predicted 782
7 SASI_Rn02_00342651 predicted 2096
8 SASI_Rn02_00342652 predicted 670
9 SASI_Rn02_00342653 predicted 965
10 SASI_Rn02_00342654 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118995 predicted 2030
2 SASI_Mm01_00118997 predicted 764
3 SASI_Mm01_00118998 predicted 814
4 SASI_Mm01_00118999 predicted 1799
5 SASI_Mm01_00119000 predicted 1125
6 SASI_Mm01_00119001 predicted 1471
7 SASI_Mm01_00119002 predicted 1369
8 SASI_Mm01_00119003 predicted 1955
9 SASI_Mm01_00119004 predicted 2002
10 SASI_Mm02_00332362 predicted 1495
11 SASI_Mm01_00118996 predicted 1952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027530
RUFY3 MISSION shRNA Bacterial Glycerol Stock
RUN and FYVE domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027530.2-2487s1c1
Sequence:CCGGGCCCAAGATAAGGGTTTAGTACTCGAGTACTAAACCCTTATCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1221s1c1
Sequence:CCGGGATGCCAATTTCTGCATGAAACTCGAGTTTCATGCAGAAATTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1933s1c1
Sequence:CCGGCCTTAAATAGTGCAGCAAATACTCGAGTATTTGCTGCACTATTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1220s1c1
Sequence:CCGGCGATGCCAATTTCTGCATGAACTCGAGTTCATGCAGAAATTGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-733s1c1
Sequence:CCGGCGACCCATGAAGATCCCAATTCTCGAGAATTGGGATCTTCATGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027530
RUFY3 MISSION shRNA shRNA Plasmid DNA
RUN and FYVE domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027530.2-2487s1c1
Sequence:CCGGGCCCAAGATAAGGGTTTAGTACTCGAGTACTAAACCCTTATCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1221s1c1
Sequence:CCGGGATGCCAATTTCTGCATGAAACTCGAGTTTCATGCAGAAATTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1933s1c1
Sequence:CCGGCCTTAAATAGTGCAGCAAATACTCGAGTATTTGCTGCACTATTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1220s1c1
Sequence:CCGGCGATGCCAATTTCTGCATGAACTCGAGTTCATGCAGAAATTGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-733s1c1
Sequence:CCGGCGACCCATGAAGATCCCAATTCTCGAGAATTGGGATCTTCATGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027530
RUFY3 MISSION shRNA Lentiviral Transduction Particles
RUN and FYVE domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027530.2-2487s1c1
Sequence:CCGGGCCCAAGATAAGGGTTTAGTACTCGAGTACTAAACCCTTATCTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1221s1c1
Sequence:CCGGGATGCCAATTTCTGCATGAAACTCGAGTTTCATGCAGAAATTGGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1933s1c1
Sequence:CCGGCCTTAAATAGTGCAGCAAATACTCGAGTATTTGCTGCACTATTTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-1220s1c1
Sequence:CCGGCGATGCCAATTTCTGCATGAACTCGAGTTCATGCAGAAATTGGCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027530.2-733s1c1
Sequence:CCGGCGACCCATGAAGATCCCAATTCTCGAGAATTGGGATCTTCATGGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014961
VALIDATED
RUFY3 MISSION shRNA Bacterial Glycerol Stock
RUN and FYVE domain containing 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1323s21c1
Sequence:CCGGAGGACGGGAACAGCAGTAAAGCTCGAGCTTTACTGCTGTTCCCGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014961.2-1360s1c1
Sequence:CCGGGACGGTCAGATTACTGCAATTCTCGAGAATTGCAGTAATCTGACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1094s1c1
Sequence:CCGGCCTGGCTTCGTTTGGCATTAACTCGAGTTAATGCCAAACGAAGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1870s1c1
Sequence:CCGGGAACTAAACAGTCGCTTGGAACTCGAGTTCCAAGCGACTGTTTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1909s1c1
Sequence:CCGGGCTGCTACCATTAAACAACTTCTCGAGAAGTTGTTTAATGGTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014961.2-845s1c1
Sequence:CCGGGCTTGATTGAATCAGCTCTGACTCGAGTCAGAGCTGATTCAATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014961.3-2020s21c1
Sequence:CCGGGTCACGTCGCAAGTCCGATATCTCGAGATATCGGACTTGCGACGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1807s21c1
Sequence:CCGGCAAGCATGAACTTGCCTTTAACTCGAGTTAAAGGCAAGTTCATGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1659s21c1
Sequence:CCGGTACGATTGGATGTTGAGAAAGCTCGAGCTTTCTCAACATCCAATCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1834s21c1
Sequence:CCGGGAGTTCAGACTTAGGAGTAAACTCGAGTTTACTCCTAAGTCTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1497s21c1
Sequence:CCGGTTGCAAACAACAGGATCATTACTCGAGTAATGATCCTGTTGTTTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1961s21c1
Sequence:CCGGACCTTAAATAGTGCAGCAAATCTCGAGATTTGCTGCACTATTTAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014961.3-2081s21c1
Sequence:CCGGCATTTAAGCTCTGATTCTATACTCGAGTATAGAATCAGAGCTTAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014961
VALIDATED
RUFY3 MISSION shRNA shRNA Plasmid DNA
RUN and FYVE domain containing 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1323s21c1
Sequence:CCGGAGGACGGGAACAGCAGTAAAGCTCGAGCTTTACTGCTGTTCCCGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014961.2-1360s1c1
Sequence:CCGGGACGGTCAGATTACTGCAATTCTCGAGAATTGCAGTAATCTGACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1094s1c1
Sequence:CCGGCCTGGCTTCGTTTGGCATTAACTCGAGTTAATGCCAAACGAAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1870s1c1
Sequence:CCGGGAACTAAACAGTCGCTTGGAACTCGAGTTCCAAGCGACTGTTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1909s1c1
Sequence:CCGGGCTGCTACCATTAAACAACTTCTCGAGAAGTTGTTTAATGGTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014961.2-845s1c1
Sequence:CCGGGCTTGATTGAATCAGCTCTGACTCGAGTCAGAGCTGATTCAATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014961.3-2020s21c1
Sequence:CCGGGTCACGTCGCAAGTCCGATATCTCGAGATATCGGACTTGCGACGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1807s21c1
Sequence:CCGGCAAGCATGAACTTGCCTTTAACTCGAGTTAAAGGCAAGTTCATGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1659s21c1
Sequence:CCGGTACGATTGGATGTTGAGAAAGCTCGAGCTTTCTCAACATCCAATCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1834s21c1
Sequence:CCGGGAGTTCAGACTTAGGAGTAAACTCGAGTTTACTCCTAAGTCTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1497s21c1
Sequence:CCGGTTGCAAACAACAGGATCATTACTCGAGTAATGATCCTGTTGTTTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1961s21c1
Sequence:CCGGACCTTAAATAGTGCAGCAAATCTCGAGATTTGCTGCACTATTTAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014961.3-2081s21c1
Sequence:CCGGCATTTAAGCTCTGATTCTATACTCGAGTATAGAATCAGAGCTTAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014961
VALIDATED
RUFY3 MISSION shRNA Lentiviral Transduction Particles
RUN and FYVE domain containing 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1323s21c1
Sequence:CCGGAGGACGGGAACAGCAGTAAAGCTCGAGCTTTACTGCTGTTCCCGTCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014961.2-1360s1c1
Sequence:CCGGGACGGTCAGATTACTGCAATTCTCGAGAATTGCAGTAATCTGACCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1094s1c1
Sequence:CCGGCCTGGCTTCGTTTGGCATTAACTCGAGTTAATGCCAAACGAAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1870s1c1
Sequence:CCGGGAACTAAACAGTCGCTTGGAACTCGAGTTCCAAGCGACTGTTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014961.2-1909s1c1
Sequence:CCGGGCTGCTACCATTAAACAACTTCTCGAGAAGTTGTTTAATGGTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014961.2-845s1c1
Sequence:CCGGGCTTGATTGAATCAGCTCTGACTCGAGTCAGAGCTGATTCAATCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014961.3-2020s21c1
Sequence:CCGGGTCACGTCGCAAGTCCGATATCTCGAGATATCGGACTTGCGACGTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1807s21c1
Sequence:CCGGCAAGCATGAACTTGCCTTTAACTCGAGTTAAAGGCAAGTTCATGCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1659s21c1
Sequence:CCGGTACGATTGGATGTTGAGAAAGCTCGAGCTTTCTCAACATCCAATCGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1834s21c1
Sequence:CCGGGAGTTCAGACTTAGGAGTAAACTCGAGTTTACTCCTAAGTCTGAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1497s21c1
Sequence:CCGGTTGCAAACAACAGGATCATTACTCGAGTAATGATCCTGTTGTTTGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014961.3-1961s21c1
Sequence:CCGGACCTTAAATAGTGCAGCAAATCTCGAGATTTGCTGCACTATTTAAGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014961.3-2081s21c1
Sequence:CCGGCATTTAAGCTCTGATTCTATACTCGAGTATAGAATCAGAGCTTAAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)