EMAIL THIS PAGE TO A FRIEND

RUNDC3A

RUN domain containing 3A

92 Gene Product Result for
Synonyms: RAP2IP RPIP-8 RPIP8
UniProtKB ID: Q59EK9, B2R974, O15483, O60651, Q7Z3S2, Q9UF50
Gene ID:
Mouse(51799) RUN domain containing 3A
Rat(303569) RUN domain containing 3A
domestic guinea pig(100728503) RUN domain containing 3A
naked mole-rat(101716092) RUN domain containing 3A
cow(614322) RUN domain containing 3A
sheep(101116160) RUN domain containing 3A
chicken(100858314) RUN domain containing 3A
domestic cat(101099670) RUN domain containing 3A
Horse(100064672) RUN domain containing 3A
dog(480502) RUN domain containing 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006695 Rosetta Predictions human pricing
NM_198758 Rosetta Predictions rat pricing
NM_016759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097868 predicted 537
2 SASI_Hs01_00097869 predicted 755
3 SASI_Hs01_00097870 predicted 552
4 SASI_Hs01_00097871 predicted 1162
5 SASI_Hs01_00097872 predicted 310
6 SASI_Hs01_00097874 predicted 1124
7 SASI_Hs01_00097875 predicted 724
8 SASI_Hs01_00097876 predicted 295
9 SASI_Hs01_00097877 predicted 381
10 SASI_Hs02_00342117 predicted 740
11 SASI_Hs01_00097873 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269990 predicted 767
2 SASI_Rn01_00100065 predicted 1697
3 SASI_Rn02_00269991 predicted 669
4 SASI_Rn02_00269992 predicted 712
5 SASI_Rn02_00269993 predicted 643
6 SASI_Rn02_00269994 predicted 759
7 SASI_Rn02_00269995 predicted 552
8 SASI_Rn02_00269996 predicted 436
9 SASI_Rn01_00100067 predicted 1512
10 SASI_Rn02_00269997 predicted 623
11 SASI_Rn01_00100063 predicted 699
12 SASI_Rn01_00100064 predicted 525
13 SASI_Rn01_00100066 predicted 651
14 SASI_Rn01_00100068 predicted 641
15 SASI_Rn01_00100069 predicted 658
16 SASI_Rn01_00100070 predicted 361
17 SASI_Rn01_00100071 predicted 479
18 SASI_Rn01_00100072 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171549 predicted 1003
2 SASI_Mm01_00171550 predicted 724
3 SASI_Mm01_00171551 predicted 557
4 SASI_Mm01_00171552 predicted 427
5 SASI_Mm01_00171553 predicted 1251
6 SASI_Mm01_00171554 predicted 389
7 SASI_Mm01_00171555 predicted 1064
8 SASI_Mm01_00171556 predicted 590
9 SASI_Mm01_00171557 predicted 1545
10 SASI_Mm01_00171558 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016759
RUNDC3A MISSION shRNA Bacterial Glycerol Stock
RUN domain containing 3A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-597s21c1
Sequence:CCGGCGATTACACACCCTACCTAAACTCGAGTTTAGGTAGGGTGTGTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-405s21c1
Sequence:CCGGGAAGCGTATGTCGGAATACATCTCGAGATGTATTCCGACATACGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016759.2-1610s21c1
Sequence:CCGGCCTGGTTCCTTCTGATTTCTTCTCGAGAAGAAATCAGAAGGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-405s1c1
Sequence:CCGGGAAGCGTATGTCGGAATACATCTCGAGATGTATTCCGACATACGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016759.1-1610s1c1
Sequence:CCGGCCTGGTTCCTTCTGATTTCTTCTCGAGAAGAAATCAGAAGGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-1066s1c1
Sequence:CCGGGCCAGCAACTCCAAGCTATATCTCGAGATATAGCTTGGAGTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-726s21c1
Sequence:CCGGCGATGAAGACAGTTGGTACAACTCGAGTTGTACCAACTGTCTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-726s1c1
Sequence:CCGGCGATGAAGACAGTTGGTACAACTCGAGTTGTACCAACTGTCTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-597s1c1
Sequence:CCGGCGATTACACACCCTACCTAAACTCGAGTTTAGGTAGGGTGTGTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016759
RUNDC3A MISSION shRNA shRNA Plasmid DNA
RUN domain containing 3A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-597s21c1
Sequence:CCGGCGATTACACACCCTACCTAAACTCGAGTTTAGGTAGGGTGTGTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-405s21c1
Sequence:CCGGGAAGCGTATGTCGGAATACATCTCGAGATGTATTCCGACATACGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016759.2-1610s21c1
Sequence:CCGGCCTGGTTCCTTCTGATTTCTTCTCGAGAAGAAATCAGAAGGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-405s1c1
Sequence:CCGGGAAGCGTATGTCGGAATACATCTCGAGATGTATTCCGACATACGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016759.1-1610s1c1
Sequence:CCGGCCTGGTTCCTTCTGATTTCTTCTCGAGAAGAAATCAGAAGGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-1066s1c1
Sequence:CCGGGCCAGCAACTCCAAGCTATATCTCGAGATATAGCTTGGAGTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-726s21c1
Sequence:CCGGCGATGAAGACAGTTGGTACAACTCGAGTTGTACCAACTGTCTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-726s1c1
Sequence:CCGGCGATGAAGACAGTTGGTACAACTCGAGTTGTACCAACTGTCTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-597s1c1
Sequence:CCGGCGATTACACACCCTACCTAAACTCGAGTTTAGGTAGGGTGTGTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016759
RUNDC3A MISSION shRNA Lentiviral Transduction Particles
RUN domain containing 3A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-597s21c1
Sequence:CCGGCGATTACACACCCTACCTAAACTCGAGTTTAGGTAGGGTGTGTAATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-405s21c1
Sequence:CCGGGAAGCGTATGTCGGAATACATCTCGAGATGTATTCCGACATACGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016759.2-1610s21c1
Sequence:CCGGCCTGGTTCCTTCTGATTTCTTCTCGAGAAGAAATCAGAAGGAACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-405s1c1
Sequence:CCGGGAAGCGTATGTCGGAATACATCTCGAGATGTATTCCGACATACGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016759.1-1610s1c1
Sequence:CCGGCCTGGTTCCTTCTGATTTCTTCTCGAGAAGAAATCAGAAGGAACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-1066s1c1
Sequence:CCGGGCCAGCAACTCCAAGCTATATCTCGAGATATAGCTTGGAGTTGCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016759.2-726s21c1
Sequence:CCGGCGATGAAGACAGTTGGTACAACTCGAGTTGTACCAACTGTCTTCATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-726s1c1
Sequence:CCGGCGATGAAGACAGTTGGTACAACTCGAGTTGTACCAACTGTCTTCATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016759.1-597s1c1
Sequence:CCGGCGATTACACACCCTACCTAAACTCGAGTTTAGGTAGGGTGTGTAATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006695
RUNDC3A MISSION shRNA Bacterial Glycerol Stock
RUN domain containing 3A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-849s1c1
Sequence:CCGGCCTAAAGTTCACGCAGAGCTACTCGAGTAGCTCTGCGTGAACTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-642s1c1
Sequence:CCGGGAAGCGCATGTCAGAATACATCTCGAGATGTATTCTGACATGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006695.3-1545s1c1
Sequence:CCGGGTTCTCCCTATGCCTGAATATCTCGAGATATTCAGGCATAGGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-561s1c1
Sequence:CCGGTGTGAGCAGCATCGAGAACATCTCGAGATGTTCTCGATGCTGCTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-570s1c1
Sequence:CCGGCATCGAGAACATGGAGAACATCTCGAGATGTTCTCCATGTTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006695
RUNDC3A MISSION shRNA shRNA Plasmid DNA
RUN domain containing 3A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-849s1c1
Sequence:CCGGCCTAAAGTTCACGCAGAGCTACTCGAGTAGCTCTGCGTGAACTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-642s1c1
Sequence:CCGGGAAGCGCATGTCAGAATACATCTCGAGATGTATTCTGACATGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006695.3-1545s1c1
Sequence:CCGGGTTCTCCCTATGCCTGAATATCTCGAGATATTCAGGCATAGGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-561s1c1
Sequence:CCGGTGTGAGCAGCATCGAGAACATCTCGAGATGTTCTCGATGCTGCTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-570s1c1
Sequence:CCGGCATCGAGAACATGGAGAACATCTCGAGATGTTCTCCATGTTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006695
RUNDC3A MISSION shRNA Lentiviral Transduction Particles
RUN domain containing 3A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-849s1c1
Sequence:CCGGCCTAAAGTTCACGCAGAGCTACTCGAGTAGCTCTGCGTGAACTTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-642s1c1
Sequence:CCGGGAAGCGCATGTCAGAATACATCTCGAGATGTATTCTGACATGCGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006695.3-1545s1c1
Sequence:CCGGGTTCTCCCTATGCCTGAATATCTCGAGATATTCAGGCATAGGGAGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-561s1c1
Sequence:CCGGTGTGAGCAGCATCGAGAACATCTCGAGATGTTCTCGATGCTGCTCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006695.3-570s1c1
Sequence:CCGGCATCGAGAACATGGAGAACATCTCGAGATGTTCTCCATGTTCTCGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???