EMAIL THIS PAGE TO A FRIEND

RWDD2A

RWD domain containing 2A

68 Gene Product Result for
Synonyms: RWDD2 dJ747H23.2
UniProtKB ID: Q9UIY3, E1P548, Q2M3R3, Q96FH1
Gene ID:
Mouse(69519) RWD domain containing 2A
Rat(363110) RWD domain containing 2A
chicken(421840) RWD domain containing 2A
domestic cat(101081893) RWD domain containing 2A
dog(481901) RWD domain containing 2A
naked mole-rat(101716785) RWD domain containing 2A
domestic guinea pig(100726775) RWD domain containing 2A
cow(539733) RWD domain containing 2A
sheep(101115546) RWD domain containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033411 Rosetta Predictions human pricing
NM_001108773 Rosetta Predictions rat pricing
NM_027100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178097 predicted 1022
2 SASI_Hs01_00178098 predicted 587
3 SASI_Hs01_00178099 predicted 1182
4 SASI_Hs01_00178100 predicted 703
5 SASI_Hs01_00178101 predicted 579
6 SASI_Hs01_00178102 predicted 746
7 SASI_Hs01_00178103 predicted 919
8 SASI_Hs01_00178104 predicted 733
9 SASI_Hs02_00361306 predicted 535
10 SASI_Hs01_00178106 predicted 648
11 SASI_Hs01_00178105 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241935 predicted 481
2 SASI_Rn02_00241936 predicted 800
3 SASI_Rn02_00241937 predicted 546
4 SASI_Rn02_00241938 predicted 333
5 SASI_Rn02_00241939 predicted 876
6 SASI_Rn02_00241940 predicted 655
7 SASI_Rn02_00241941 predicted 730
8 SASI_Rn02_00241942 predicted 643
9 SASI_Rn02_00241943 predicted 503
10 SASI_Rn02_00241944 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053012 predicted 1058
2 SASI_Mm01_00053014 predicted 659
3 SASI_Mm01_00053015 predicted 400
4 SASI_Mm01_00053017 predicted 720
5 SASI_Mm02_00331536 predicted 292
6 SASI_Mm01_00053018 predicted 936
7 SASI_Mm01_00053020 predicted 254
8 SASI_Mm02_00331537 predicted 430
9 SASI_Mm02_00331538 predicted 884
10 SASI_Mm02_00331539 predicted 298
11 SASI_Mm01_00053013 predicted 1085
12 SASI_Mm01_00053016 predicted 286
13 SASI_Mm01_00053019 predicted 585
14 SASI_Mm01_00053021 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033411
RWDD2A MISSION shRNA Bacterial Glycerol Stock
RWD domain containing 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-748s21c1
Sequence:CCGGGATCTACAGTCACCATATATACTCGAGTATATATGGTGACTGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-809s21c1
Sequence:CCGGAGGTTAGATGTGACTGGATTTCTCGAGAAATCCAGTCACATCTAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-676s21c1
Sequence:CCGGCCTGAACAGAAAGCTTGTATACTCGAGTATACAAGCTTTCTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-491s1c1
Sequence:CCGGGCTCTGTGTATGTGCAGCAATCTCGAGATTGCTGCACATACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-885s1c1
Sequence:CCGGGCTCATGGTGACTATGGATTACTCGAGTAATCCATAGTCACCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033411.2-1035s1c1
Sequence:CCGGCCTATGCCTGTAATTTCACTACTCGAGTAGTGAAATTACAGGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-458s1c1
Sequence:CCGGCACTTCTTACATAGGGACTTTCTCGAGAAAGTCCCTATGTAAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-248s1c1
Sequence:CCGGCCTGACGAATATAAAGAGGTACTCGAGTACCTCTTTATATTCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033411
RWDD2A MISSION shRNA shRNA Plasmid DNA
RWD domain containing 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-748s21c1
Sequence:CCGGGATCTACAGTCACCATATATACTCGAGTATATATGGTGACTGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-809s21c1
Sequence:CCGGAGGTTAGATGTGACTGGATTTCTCGAGAAATCCAGTCACATCTAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-676s21c1
Sequence:CCGGCCTGAACAGAAAGCTTGTATACTCGAGTATACAAGCTTTCTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-491s1c1
Sequence:CCGGGCTCTGTGTATGTGCAGCAATCTCGAGATTGCTGCACATACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-885s1c1
Sequence:CCGGGCTCATGGTGACTATGGATTACTCGAGTAATCCATAGTCACCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033411.2-1035s1c1
Sequence:CCGGCCTATGCCTGTAATTTCACTACTCGAGTAGTGAAATTACAGGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-458s1c1
Sequence:CCGGCACTTCTTACATAGGGACTTTCTCGAGAAAGTCCCTATGTAAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-248s1c1
Sequence:CCGGCCTGACGAATATAAAGAGGTACTCGAGTACCTCTTTATATTCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033411
RWDD2A MISSION shRNA Lentiviral Transduction Particles
RWD domain containing 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-748s21c1
Sequence:CCGGGATCTACAGTCACCATATATACTCGAGTATATATGGTGACTGTAGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-809s21c1
Sequence:CCGGAGGTTAGATGTGACTGGATTTCTCGAGAAATCCAGTCACATCTAACCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033411.3-676s21c1
Sequence:CCGGCCTGAACAGAAAGCTTGTATACTCGAGTATACAAGCTTTCTGTTCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-491s1c1
Sequence:CCGGGCTCTGTGTATGTGCAGCAATCTCGAGATTGCTGCACATACACAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-885s1c1
Sequence:CCGGGCTCATGGTGACTATGGATTACTCGAGTAATCCATAGTCACCATGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033411.2-1035s1c1
Sequence:CCGGCCTATGCCTGTAATTTCACTACTCGAGTAGTGAAATTACAGGCATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-458s1c1
Sequence:CCGGCACTTCTTACATAGGGACTTTCTCGAGAAAGTCCCTATGTAAGAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033411.2-248s1c1
Sequence:CCGGCCTGACGAATATAAAGAGGTACTCGAGTACCTCTTTATATTCGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027100
RWDD2A MISSION shRNA Bacterial Glycerol Stock
RWD domain containing 2A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027100.1-1086s1c1
Sequence:CCGGCTACGCTTGTAACCGCATTAACTCGAGTTAATGCGGTTACAAGCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027100.1-955s1c1
Sequence:CCGGGCGGAATGATTATCACATGAACTCGAGTTCATGTGATAATCATTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-394s21c1
Sequence:CCGGGACCATTGATTTGCAAGTAACCTCGAGGTTACTTGCAAATCAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027100.1-1086s21c1
Sequence:CCGGCTACGCTTGTAACCGCATTAACTCGAGTTAATGCGGTTACAAGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-654s21c1
Sequence:CCGGTCCTCCGCATGTGGATCTATACTCGAGTATAGATCCACATGCGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-1060s21c1
Sequence:CCGGAGAGTCCTAGAACCCTATTAACTCGAGTTAATAGGGTTCTAGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-754s21c1
Sequence:CCGGGACAGGAAAGCCTGGTATAATCTCGAGATTATACCAGGCTTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027100.1-1089s1c1
Sequence:CCGGCGCTTGTAACCGCATTAAGTACTCGAGTACTTAATGCGGTTACAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027100.1-394s1c1
Sequence:CCGGGACCATTGATTTGCAAGTAACCTCGAGGTTACTTGCAAATCAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027100
RWDD2A MISSION shRNA shRNA Plasmid DNA
RWD domain containing 2A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027100.1-1086s1c1
Sequence:CCGGCTACGCTTGTAACCGCATTAACTCGAGTTAATGCGGTTACAAGCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027100.1-955s1c1
Sequence:CCGGGCGGAATGATTATCACATGAACTCGAGTTCATGTGATAATCATTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-394s21c1
Sequence:CCGGGACCATTGATTTGCAAGTAACCTCGAGGTTACTTGCAAATCAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027100.1-1086s21c1
Sequence:CCGGCTACGCTTGTAACCGCATTAACTCGAGTTAATGCGGTTACAAGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-654s21c1
Sequence:CCGGTCCTCCGCATGTGGATCTATACTCGAGTATAGATCCACATGCGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-1060s21c1
Sequence:CCGGAGAGTCCTAGAACCCTATTAACTCGAGTTAATAGGGTTCTAGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-754s21c1
Sequence:CCGGGACAGGAAAGCCTGGTATAATCTCGAGATTATACCAGGCTTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027100.1-1089s1c1
Sequence:CCGGCGCTTGTAACCGCATTAAGTACTCGAGTACTTAATGCGGTTACAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027100.1-394s1c1
Sequence:CCGGGACCATTGATTTGCAAGTAACCTCGAGGTTACTTGCAAATCAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027100
RWDD2A MISSION shRNA Lentiviral Transduction Particles
RWD domain containing 2A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027100.1-1086s1c1
Sequence:CCGGCTACGCTTGTAACCGCATTAACTCGAGTTAATGCGGTTACAAGCGTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027100.1-955s1c1
Sequence:CCGGGCGGAATGATTATCACATGAACTCGAGTTCATGTGATAATCATTCCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-394s21c1
Sequence:CCGGGACCATTGATTTGCAAGTAACCTCGAGGTTACTTGCAAATCAATGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027100.1-1086s21c1
Sequence:CCGGCTACGCTTGTAACCGCATTAACTCGAGTTAATGCGGTTACAAGCGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-654s21c1
Sequence:CCGGTCCTCCGCATGTGGATCTATACTCGAGTATAGATCCACATGCGGAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000258117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-1060s21c1
Sequence:CCGGAGAGTCCTAGAACCCTATTAACTCGAGTTAATAGGGTTCTAGGACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027100.1-754s21c1
Sequence:CCGGGACAGGAAAGCCTGGTATAATCTCGAGATTATACCAGGCTTTCCTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027100.1-1089s1c1
Sequence:CCGGCGCTTGTAACCGCATTAAGTACTCGAGTACTTAATGCGGTTACAAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027100.1-394s1c1
Sequence:CCGGGACCATTGATTTGCAAGTAACCTCGAGGTTACTTGCAAATCAATGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???