EMAIL THIS PAGE TO A FRIEND

RXRA

retinoid X receptor, alpha

110 Gene Product Result for
Synonyms: NR2B1
UniProtKB ID: P19793, Q2NL52, Q2V504
Gene ID:
Human(6256) Summary: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs), are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors exert their action by binding, as homodimers or heterodimers, to specific sequences in the promoters of target genes and regulating their transcription. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. [provided by RefSeq, Jul 2008]
Mouse(20181) retinoid X receptor alpha
Rat(25271) retinoid X receptor alpha
chicken(417143) retinoid X receptor, alpha
domestic cat(101085757) retinoid X receptor, alpha
dog(491278) retinoid X receptor, alpha
cow(507554) retinoid X receptor, alpha
naked mole-rat(101723948) retinoid X receptor, alpha
domestic guinea pig(100728437) retinoid X receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
T3757 TTNPB human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
R4643 9-cis-Retinoic acid ≥98% (HPLC) human pricing
R2625 Retinoic acid ≥98% (HPLC), powder human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002957 Rosetta Predictions human pricing
NM_012805 Rosetta Predictions rat pricing
NM_011305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097638 predicted 1611
2 SASI_Hs01_00097639 predicted 1599
3 SASI_Hs01_00097640 predicted 1297
4 SASI_Hs01_00097641 predicted 803
5 SASI_Hs02_00334805 predicted 1348
6 SASI_Hs01_00097643 predicted 845
7 SASI_Hs01_00097644 predicted 1615
8 SASI_Hs01_00097646 predicted 980
9 SASI_Hs01_00097647 predicted 565
10 SASI_Hs02_00334806 predicted 695
11 SASI_Hs01_00097642 predicted 341
12 SASI_Hs01_00097645 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065764 predicted 517
2 SASI_Rn01_00065765 predicted 402
3 SASI_Rn01_00065766 predicted 570
4 SASI_Rn01_00065770 predicted 730
5 SASI_Rn02_00260244 predicted 1131
6 SASI_Rn01_00065771 predicted 1086
7 SASI_Rn01_00065772 predicted 647
8 SASI_Rn02_00260245 predicted 385
9 SASI_Rn02_00260246 predicted 230
10 SASI_Rn02_00260247 predicted 809
11 SASI_Rn01_00065767 predicted 339
12 SASI_Rn01_00065768 predicted 463
13 SASI_Rn01_00065769 predicted 1802
14 SASI_Rn01_00065773 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140617 predicted 1034
2 SASI_Mm01_00140618 predicted 1361
3 SASI_Mm01_00140619 predicted 2041
4 SASI_Mm01_00140620 predicted 2120
5 SASI_Mm01_00140621 predicted 1316
6 SASI_Mm01_00140622 predicted 489
7 SASI_Mm02_00320378 predicted 1851
8 SASI_Mm01_00140624 predicted 1290
9 SASI_Mm01_00140625 predicted 560
10 SASI_Mm01_00140626 predicted 1423
11 SASI_Mm01_00140623 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002957
VALIDATED
RXRA MISSION shRNA Bacterial Glycerol Stock
retinoid X receptor, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002957.4-1233s21c1
Sequence:CCGGGCGGGACATGCAGATGGACAACTCGAGTTGTCCATCTGCATGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-1436s21c1
Sequence:CCGGTGCGCTCCATCGGGCTCAAATCTCGAGATTTGAGCCCGATGGAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002957.4-1701s21c1
Sequence:CCGGGTGTTGTCACCCTCCTTATTTCTCGAGAAATAAGGAGGGTGACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-684s21c1
Sequence:CCGGCAAGGACTGCCTGATTGACAACTCGAGTTGTCAATCAGGCAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-947s21c1
Sequence:CCGGACGACCCTGTCACCAACATTTCTCGAGAAATGTTGGTGACAGGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002957.3-499s1c1
Sequence:CCGGGCAAGCACTATGGAGTGTACACTCGAGTGTACACTCCATAGTGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002957.3-1190s1c1
Sequence:CCGGCCTCTTTAACCCTGACTCCAACTCGAGTTGGAGTCAGGGTTAAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002957.3-95s1c1
Sequence:CCGGCGATTTCTCCACCCAGGTGAACTCGAGTTCACCTGGGTGGAGAAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002957.3-858s1c1
Sequence:CCGGCCTGTCACCAACATTTGCCAACTCGAGTTGGCAAATGTTGGTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002957
VALIDATED
RXRA MISSION shRNA shRNA Plasmid DNA
retinoid X receptor, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002957.4-1233s21c1
Sequence:CCGGGCGGGACATGCAGATGGACAACTCGAGTTGTCCATCTGCATGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-1436s21c1
Sequence:CCGGTGCGCTCCATCGGGCTCAAATCTCGAGATTTGAGCCCGATGGAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002957.4-1701s21c1
Sequence:CCGGGTGTTGTCACCCTCCTTATTTCTCGAGAAATAAGGAGGGTGACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-684s21c1
Sequence:CCGGCAAGGACTGCCTGATTGACAACTCGAGTTGTCAATCAGGCAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-947s21c1
Sequence:CCGGACGACCCTGTCACCAACATTTCTCGAGAAATGTTGGTGACAGGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002957.3-499s1c1
Sequence:CCGGGCAAGCACTATGGAGTGTACACTCGAGTGTACACTCCATAGTGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002957.3-1190s1c1
Sequence:CCGGCCTCTTTAACCCTGACTCCAACTCGAGTTGGAGTCAGGGTTAAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002957.3-95s1c1
Sequence:CCGGCGATTTCTCCACCCAGGTGAACTCGAGTTCACCTGGGTGGAGAAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002957.3-858s1c1
Sequence:CCGGCCTGTCACCAACATTTGCCAACTCGAGTTGGCAAATGTTGGTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002957
VALIDATED
RXRA MISSION shRNA Lentiviral Transduction Particles
retinoid X receptor, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002957.4-1233s21c1
Sequence:CCGGGCGGGACATGCAGATGGACAACTCGAGTTGTCCATCTGCATGTCCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-1436s21c1
Sequence:CCGGTGCGCTCCATCGGGCTCAAATCTCGAGATTTGAGCCCGATGGAGCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002957.4-1701s21c1
Sequence:CCGGGTGTTGTCACCCTCCTTATTTCTCGAGAAATAAGGAGGGTGACAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-684s21c1
Sequence:CCGGCAAGGACTGCCTGATTGACAACTCGAGTTGTCAATCAGGCAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_002957.4-947s21c1
Sequence:CCGGACGACCCTGTCACCAACATTTCTCGAGAAATGTTGGTGACAGGGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002957.3-499s1c1
Sequence:CCGGGCAAGCACTATGGAGTGTACACTCGAGTGTACACTCCATAGTGCTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002957.3-1190s1c1
Sequence:CCGGCCTCTTTAACCCTGACTCCAACTCGAGTTGGAGTCAGGGTTAAAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002957.3-95s1c1
Sequence:CCGGCGATTTCTCCACCCAGGTGAACTCGAGTTCACCTGGGTGGAGAAATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002957.3-858s1c1
Sequence:CCGGCCTGTCACCAACATTTGCCAACTCGAGTTGGCAAATGTTGGTGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011305
VALIDATED
RXRA MISSION shRNA Bacterial Glycerol Stock
retinoid X receptor, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-883s1c1
Sequence:CCGGCCTGTAGAGAAGATTCTGGAACTCGAGTTCCAGAATCTTCTCTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-1314s1c1
Sequence:CCGGCCTGTTCAACCCTGACTCTAACTCGAGTTAGAGTCAGGGTTGAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011305.2-561s1c1
Sequence:CCGGCTCAGGAAATATGGCCTCCTTCTCGAGAAGGAGGCCATATTTCCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-982s1c1
Sequence:CCGGCCTGTTACCAACATCTGTCAACTCGAGTTGACAGATGTTGGTAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-468s1c1
Sequence:CCGGCCAGCTCAATTCACCCATGAACTCGAGTTCATGGGTGAATTGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011305
VALIDATED
RXRA MISSION shRNA shRNA Plasmid DNA
retinoid X receptor, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-883s1c1
Sequence:CCGGCCTGTAGAGAAGATTCTGGAACTCGAGTTCCAGAATCTTCTCTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-1314s1c1
Sequence:CCGGCCTGTTCAACCCTGACTCTAACTCGAGTTAGAGTCAGGGTTGAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011305.2-561s1c1
Sequence:CCGGCTCAGGAAATATGGCCTCCTTCTCGAGAAGGAGGCCATATTTCCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-982s1c1
Sequence:CCGGCCTGTTACCAACATCTGTCAACTCGAGTTGACAGATGTTGGTAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-468s1c1
Sequence:CCGGCCAGCTCAATTCACCCATGAACTCGAGTTCATGGGTGAATTGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011305
VALIDATED
RXRA MISSION shRNA Lentiviral Transduction Particles
retinoid X receptor, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-883s1c1
Sequence:CCGGCCTGTAGAGAAGATTCTGGAACTCGAGTTCCAGAATCTTCTCTACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-1314s1c1
Sequence:CCGGCCTGTTCAACCCTGACTCTAACTCGAGTTAGAGTCAGGGTTGAACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011305.2-561s1c1
Sequence:CCGGCTCAGGAAATATGGCCTCCTTCTCGAGAAGGAGGCCATATTTCCTGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-982s1c1
Sequence:CCGGCCTGTTACCAACATCTGTCAACTCGAGTTGACAGATGTTGGTAACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011305.2-468s1c1
Sequence:CCGGCCAGCTCAATTCACCCATGAACTCGAGTTCATGGGTGAATTGAGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)