EMAIL THIS PAGE TO A FRIEND

RXRG

retinoid X receptor, gamma

66 Gene Product Result for
Synonyms: NR2B3 RXRC
UniProtKB ID: P48443, A6NIP1, Q6IBU7
Gene ID:
Human(6258) Summary: This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
Mouse(20183) retinoid X receptor gamma
Rat(83574) retinoid X receptor gamma
chicken(396231) retinoid X receptor, gamma
domestic cat(101081273) retinoid X receptor, gamma
dog(478989) retinoid X receptor, gamma
cow(509500) retinoid X receptor, gamma
sheep(101111845) retinoid X receptor, gamma
domestic guinea pig(100731736) retinoid X receptor, gamma
naked mole-rat(101716819) retinoid X receptor, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
T3757 TTNPB human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
R4643 9-cis-Retinoic acid ≥98% (HPLC) human pricing
R2625 Retinoic acid ≥98% (HPLC), powder human, mouse pricing

Proteins

Product # Description Species Add to Cart
 
APREST94047 PrEST Antigen RXRG Prestige Antigens Powered by Atlas Antibodies human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009598 Rosetta Predictions human pricing
NM_006917 Rosetta Predictions human pricing
NM_031765 Rosetta Predictions rat pricing
NM_009107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088544 predicted 335
2 SASI_Hs01_00088545 predicted 377
3 SASI_Hs01_00088546 predicted 376
4 SASI_Hs01_00088547 predicted 327
5 SASI_Hs01_00088548 predicted 337
6 SASI_Hs01_00088549 predicted 383
7 SASI_Hs01_00088550 predicted 338
8 SASI_Hs01_00088552 predicted 326
9 SASI_Hs01_00088551 predicted 363
10 SASI_Hs02_00305648 predicted 532
11 SASI_Hs01_00088553 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020741 predicted 1132
2 SASI_Hs01_00020742 predicted 808
3 SASI_Hs01_00020743 predicted 1409
4 SASI_Hs01_00020744 predicted 1092
5 SASI_Hs01_00020745 predicted 1078
6 SASI_Hs01_00020746 predicted 1095
7 SASI_Hs01_00020747 predicted 1341
8 SASI_Hs01_00020748 predicted 1042
9 SASI_Hs02_00342596 predicted 1481
10 SASI_Hs01_00020749 predicted 588
11 SASI_Hs01_00020750 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265193 predicted 1394
2 SASI_Rn01_00121655 predicted 740
3 SASI_Rn01_00121656 predicted 230
4 SASI_Rn01_00121657 predicted 683
5 SASI_Rn01_00121658 predicted 1606
6 SASI_Rn01_00121659 predicted 1052
7 SASI_Rn01_00121660 predicted 232
8 SASI_Rn01_00121661 predicted 524
9 SASI_Rn01_00121662 predicted 975
10 SASI_Rn01_00121663 predicted 1346
11 SASI_Rn01_00121664 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112334 predicted 1097
2 SASI_Mm01_00112335 predicted 1535
3 SASI_Mm01_00112336 predicted 825
4 SASI_Mm01_00112337 predicted 667
5 SASI_Mm01_00112338 predicted 877
6 SASI_Mm01_00112339 predicted 1743
7 SASI_Mm01_00112340 predicted 1488
8 SASI_Mm01_00112341 predicted 1418
9 SASI_Mm01_00112343 predicted 1112
10 SASI_Mm02_00315367 predicted 1080
11 SASI_Mm01_00112342 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009107
RXRG MISSION shRNA Bacterial Glycerol Stock
retinoid X receptor, gamma
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009107.3-1563s21c1
Sequence:CCGGGACTCTTCGAGAGAAGGTTTACTCGAGTAAACCTTCTCTCGAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009107.3-1973s21c1
Sequence:CCGGGTGGCCCTTCTTTGCTATTTACTCGAGTAAATAGCAAAGAAGGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1131s1c1
Sequence:CCGGCGGTGACATGAACGTGGAGAACTCGAGTTCTCCACGTTCATGTCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1497s1c1
Sequence:CCGGGCTGTTTAACCCAGATGCCAACTCGAGTTGGCATCTGGGTTAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-575s1c1
Sequence:CCGGCTCCGTATAGAGTCATCACTTCTCGAGAAGTGATGACTCTATACGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1439s1c1
Sequence:CCGGCCAAGATGAAAGACATGCAGACTCGAGTCTGCATGTCTTTCATCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-885s1c1
Sequence:CCGGCATCTACACCTGTCGGGATAACTCGAGTTATCCCGACAGGTGTAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009107
RXRG MISSION shRNA shRNA Plasmid DNA
retinoid X receptor, gamma
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009107.3-1563s21c1
Sequence:CCGGGACTCTTCGAGAGAAGGTTTACTCGAGTAAACCTTCTCTCGAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009107.3-1973s21c1
Sequence:CCGGGTGGCCCTTCTTTGCTATTTACTCGAGTAAATAGCAAAGAAGGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1131s1c1
Sequence:CCGGCGGTGACATGAACGTGGAGAACTCGAGTTCTCCACGTTCATGTCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1497s1c1
Sequence:CCGGGCTGTTTAACCCAGATGCCAACTCGAGTTGGCATCTGGGTTAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-575s1c1
Sequence:CCGGCTCCGTATAGAGTCATCACTTCTCGAGAAGTGATGACTCTATACGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1439s1c1
Sequence:CCGGCCAAGATGAAAGACATGCAGACTCGAGTCTGCATGTCTTTCATCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-885s1c1
Sequence:CCGGCATCTACACCTGTCGGGATAACTCGAGTTATCCCGACAGGTGTAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009107
RXRG MISSION shRNA Lentiviral Transduction Particles
retinoid X receptor, gamma
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009107.3-1563s21c1
Sequence:CCGGGACTCTTCGAGAGAAGGTTTACTCGAGTAAACCTTCTCTCGAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009107.3-1973s21c1
Sequence:CCGGGTGGCCCTTCTTTGCTATTTACTCGAGTAAATAGCAAAGAAGGGCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1131s1c1
Sequence:CCGGCGGTGACATGAACGTGGAGAACTCGAGTTCTCCACGTTCATGTCACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1497s1c1
Sequence:CCGGGCTGTTTAACCCAGATGCCAACTCGAGTTGGCATCTGGGTTAAACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-575s1c1
Sequence:CCGGCTCCGTATAGAGTCATCACTTCTCGAGAAGTGATGACTCTATACGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-1439s1c1
Sequence:CCGGCCAAGATGAAAGACATGCAGACTCGAGTCTGCATGTCTTTCATCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009107.2-885s1c1
Sequence:CCGGCATCTACACCTGTCGGGATAACTCGAGTTATCCCGACAGGTGTAGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006917
VALIDATED
RXRG MISSION shRNA Bacterial Glycerol Stock
retinoid X receptor, gamma
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1412s21c1
Sequence:CCGGTGCGAGCCATTGTACTCTTTACTCGAGTAAAGAGTACAATGGCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-657s21c1
Sequence:CCGGCGGGATTGGAAACATGAACTACTCGAGTAGTTCATGTTTCCAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-816s21c1
Sequence:CCGGCTACACGTGTCGGGATAATAACTCGAGTTATTATCCCGACACGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1507s21c1
Sequence:CCGGGCCTACACCAAGCAGAAGTATCTCGAGATACTTCTGCTTGGTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1088s21c1
Sequence:CCGGATGACCCTGTTACCAACATATCTCGAGATATGTTGGTAACAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-545s1c1
Sequence:CCGGCGGGATTGGAAACATGAACTACTCGAGTAGTTCATGTTTCCAATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-1234s1c1
Sequence:CCGGGAGTCCTAACTGAGCTGGTTTCTCGAGAAACCAGCTCAGTTAGGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-773s1c1
Sequence:CCGGCTATCAGAAGTGCCTTGTCATCTCGAGATGACAAGGCACTTCTGATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-1395s1c1
Sequence:CCGGGCCTACACCAAGCAGAAGTATCTCGAGATACTTCTGCTTGGTGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006917
VALIDATED
RXRG MISSION shRNA shRNA Plasmid DNA
retinoid X receptor, gamma
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1412s21c1
Sequence:CCGGTGCGAGCCATTGTACTCTTTACTCGAGTAAAGAGTACAATGGCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-657s21c1
Sequence:CCGGCGGGATTGGAAACATGAACTACTCGAGTAGTTCATGTTTCCAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-816s21c1
Sequence:CCGGCTACACGTGTCGGGATAATAACTCGAGTTATTATCCCGACACGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1507s21c1
Sequence:CCGGGCCTACACCAAGCAGAAGTATCTCGAGATACTTCTGCTTGGTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1088s21c1
Sequence:CCGGATGACCCTGTTACCAACATATCTCGAGATATGTTGGTAACAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-545s1c1
Sequence:CCGGCGGGATTGGAAACATGAACTACTCGAGTAGTTCATGTTTCCAATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-1234s1c1
Sequence:CCGGGAGTCCTAACTGAGCTGGTTTCTCGAGAAACCAGCTCAGTTAGGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-773s1c1
Sequence:CCGGCTATCAGAAGTGCCTTGTCATCTCGAGATGACAAGGCACTTCTGATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-1395s1c1
Sequence:CCGGGCCTACACCAAGCAGAAGTATCTCGAGATACTTCTGCTTGGTGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006917
VALIDATED
RXRG MISSION shRNA Lentiviral Transduction Particles
retinoid X receptor, gamma
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1412s21c1
Sequence:CCGGTGCGAGCCATTGTACTCTTTACTCGAGTAAAGAGTACAATGGCTCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-657s21c1
Sequence:CCGGCGGGATTGGAAACATGAACTACTCGAGTAGTTCATGTTTCCAATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-816s21c1
Sequence:CCGGCTACACGTGTCGGGATAATAACTCGAGTTATTATCCCGACACGTGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1507s21c1
Sequence:CCGGGCCTACACCAAGCAGAAGTATCTCGAGATACTTCTGCTTGGTGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006917.3-1088s21c1
Sequence:CCGGATGACCCTGTTACCAACATATCTCGAGATATGTTGGTAACAGGGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-545s1c1
Sequence:CCGGCGGGATTGGAAACATGAACTACTCGAGTAGTTCATGTTTCCAATCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-1234s1c1
Sequence:CCGGGAGTCCTAACTGAGCTGGTTTCTCGAGAAACCAGCTCAGTTAGGACTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-773s1c1
Sequence:CCGGCTATCAGAAGTGCCTTGTCATCTCGAGATGACAAGGCACTTCTGATAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006917.2-1395s1c1
Sequence:CCGGGCCTACACCAAGCAGAAGTATCTCGAGATACTTCTGCTTGGTGTAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)