EMAIL THIS PAGE TO A FRIEND

S100A6

S100 calcium binding protein A6

48 Gene Product Result for
Synonyms: 2A9 5B10 CABP CACY PRA
UniProtKB ID: P06703, D3DV39, Q5RHS4
Gene ID:
Human(6277) Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008]
Mouse(20200) S100 calcium binding protein A6 (calcyclin)
Rat(85247) S100 calcium binding protein A6
chicken(373951) S100 calcium binding protein A6
Horse(100033887) S100 calcium binding protein A6
domestic cat(101083651) S100 calcium binding protein A6
dog(480143) S100 calcium binding protein A6
Domestic Rabbit(100348755) S100 calcium binding protein A6
cow(618256) S100 calcium binding protein A6
sheep(101122915) S100 calcium binding protein A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007575 Anti-S100A6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0006277M10 Monoclonal Anti-S100A6 antibody produced in mouse clone 6B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
S5049 Monoclonal Anti-S100A6 antibody produced in mouse clone CACY-100, ascites fluid lizard, pig, canine, human, rat, goat, bovine
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1404345 Monoclonal Anti-S100A6, (C-terminal) antibody produced in mouse clone 6D1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1675 Human S100 A6 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014624 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120391 MISSION® esiRNA esiRNA human S100A6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014624 Rosetta Predictions human pricing
NM_053485 Rosetta Predictions rat pricing
NM_011313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139273 predicted 342
2 SASI_Hs01_00139276 predicted 390
3 SASI_Hs02_00345919 predicted 408
4 SASI_Hs01_00139274 predicted 349
5 SASI_Hs01_00139277 predicted 375
6 SASI_Hs01_00139279 predicted 372
7 SASI_Hs01_00139280 predicted 358
8 SASI_Hs01_00139281 predicted 369
9 SASI_Hs01_00139282 predicted 381
10 SASI_Hs02_00345920 predicted 365
11 SASI_Hs01_00139275 predicted 323
12 SASI_Hs01_00139278 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118126 predicted 66
2 SASI_Rn01_00118127 predicted 218
3 SASI_Rn01_00118128 predicted 89
4 SASI_Rn01_00118130 predicted 206
5 SASI_Rn01_00118131 predicted 330
6 SASI_Rn01_00118132 predicted 172
7 SASI_Rn01_00118133 predicted 67
8 SASI_Rn02_00266084 predicted 337
9 SASI_Rn01_00118134 predicted 162
10 SASI_Rn01_00118135 predicted 202
11 SASI_Rn01_00118129 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320399 predicted 357
2 SASI_Mm01_00056271 predicted 490
3 SASI_Mm01_00056273 predicted 405
4 SASI_Mm02_00320400 predicted 383
5 SASI_Mm02_00320401 predicted 391
6 SASI_Mm01_00056275 predicted 422
7 SASI_Mm01_00056276 predicted 415
8 SASI_Mm01_00056277 predicted 421
9 SASI_Mm02_00320402 predicted 390
10 SASI_Mm01_00056278 predicted 434
11 SASI_Mm01_00056270 predicted 240
12 SASI_Mm01_00056272 predicted 252
13 SASI_Mm01_00056274 predicted 286
14 SASI_Mm01_00056279 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011313
VALIDATED
S100A6 MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein A6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-592s21c1
Sequence:CCGGGCCTTGGCTTTGATCTACAATCTCGAGATTGTAGATCAAAGCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-524s21c1
Sequence:CCGGTGATGGATGATCTGGACCGTACTCGAGTACGGTCCAGATCATCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-541s21c1
Sequence:CCGGCGTAACAAGGATCAGGAAGTACTCGAGTACTTCCTGATCCTTGTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-406s21c1
Sequence:CCGGCACAAGTACTCTGGCAAGGAACTCGAGTTCCTTGCCAGAGTACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-343s1c1
Sequence:CCGGCGTAACAAGGATCAGGAAGTACTCGAGTACTTCCTGATCCTTGTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-326s1c1
Sequence:CCGGTGATGGATGATCTGGACCGTACTCGAGTACGGTCCAGATCATCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-400s1c1
Sequence:CCGGGCTTTGATCTACAATGAAGCTCTCGAGAGCTTCATTGTAGATCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-208s1c1
Sequence:CCGGCACAAGTACTCTGGCAAGGAACTCGAGTTCCTTGCCAGAGTACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011313
VALIDATED
S100A6 MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein A6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-592s21c1
Sequence:CCGGGCCTTGGCTTTGATCTACAATCTCGAGATTGTAGATCAAAGCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-524s21c1
Sequence:CCGGTGATGGATGATCTGGACCGTACTCGAGTACGGTCCAGATCATCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-541s21c1
Sequence:CCGGCGTAACAAGGATCAGGAAGTACTCGAGTACTTCCTGATCCTTGTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-406s21c1
Sequence:CCGGCACAAGTACTCTGGCAAGGAACTCGAGTTCCTTGCCAGAGTACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-343s1c1
Sequence:CCGGCGTAACAAGGATCAGGAAGTACTCGAGTACTTCCTGATCCTTGTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-326s1c1
Sequence:CCGGTGATGGATGATCTGGACCGTACTCGAGTACGGTCCAGATCATCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-400s1c1
Sequence:CCGGGCTTTGATCTACAATGAAGCTCTCGAGAGCTTCATTGTAGATCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-208s1c1
Sequence:CCGGCACAAGTACTCTGGCAAGGAACTCGAGTTCCTTGCCAGAGTACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011313
VALIDATED
S100A6 MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein A6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-592s21c1
Sequence:CCGGGCCTTGGCTTTGATCTACAATCTCGAGATTGTAGATCAAAGCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-524s21c1
Sequence:CCGGTGATGGATGATCTGGACCGTACTCGAGTACGGTCCAGATCATCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-541s21c1
Sequence:CCGGCGTAACAAGGATCAGGAAGTACTCGAGTACTTCCTGATCCTTGTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011313.2-406s21c1
Sequence:CCGGCACAAGTACTCTGGCAAGGAACTCGAGTTCCTTGCCAGAGTACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-343s1c1
Sequence:CCGGCGTAACAAGGATCAGGAAGTACTCGAGTACTTCCTGATCCTTGTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-326s1c1
Sequence:CCGGTGATGGATGATCTGGACCGTACTCGAGTACGGTCCAGATCATCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-400s1c1
Sequence:CCGGGCTTTGATCTACAATGAAGCTCTCGAGAGCTTCATTGTAGATCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011313.1-208s1c1
Sequence:CCGGCACAAGTACTCTGGCAAGGAACTCGAGTTCCTTGCCAGAGTACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014624
VALIDATED
S100A6 MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein A6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-521s21c1
Sequence:CCGGCTTCCAGGAGTATGTCACCTTCTCGAGAAGGTGACATACTCCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-350s21c1
Sequence:CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-473s21c1
Sequence:CCGGTGCAAGGCTGATGGAAGACTTCTCGAGAAGTCTTCCATCAGCCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-398s21c1
Sequence:CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-138s1c1
Sequence:CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-261s1c1
Sequence:CCGGTGCAAGGCTGATGGAAGACTTCTCGAGAAGTCTTCCATCAGCCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-186s1c1
Sequence:CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-301s1c1
Sequence:CCGGGAGGTGAACTTCCAGGAGTATCTCGAGATACTCCTGGAAGTTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-309s1c1
Sequence:CCGGCTTCCAGGAGTATGTCACCTTCTCGAGAAGGTGACATACTCCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014624
VALIDATED
S100A6 MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein A6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-521s21c1
Sequence:CCGGCTTCCAGGAGTATGTCACCTTCTCGAGAAGGTGACATACTCCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-350s21c1
Sequence:CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-473s21c1
Sequence:CCGGTGCAAGGCTGATGGAAGACTTCTCGAGAAGTCTTCCATCAGCCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-398s21c1
Sequence:CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-138s1c1
Sequence:CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-261s1c1
Sequence:CCGGTGCAAGGCTGATGGAAGACTTCTCGAGAAGTCTTCCATCAGCCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-186s1c1
Sequence:CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-301s1c1
Sequence:CCGGGAGGTGAACTTCCAGGAGTATCTCGAGATACTCCTGGAAGTTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-309s1c1
Sequence:CCGGCTTCCAGGAGTATGTCACCTTCTCGAGAAGGTGACATACTCCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014624
VALIDATED
S100A6 MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein A6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-521s21c1
Sequence:CCGGCTTCCAGGAGTATGTCACCTTCTCGAGAAGGTGACATACTCCTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-350s21c1
Sequence:CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-473s21c1
Sequence:CCGGTGCAAGGCTGATGGAAGACTTCTCGAGAAGTCTTCCATCAGCCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014624.3-398s21c1
Sequence:CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-138s1c1
Sequence:CCGGCGTGGCCATCTTCCACAAGTACTCGAGTACTTGTGGAAGATGGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-261s1c1
Sequence:CCGGTGCAAGGCTGATGGAAGACTTCTCGAGAAGTCTTCCATCAGCCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-186s1c1
Sequence:CCGGCCTGAGCAAGAAGGAGCTGAACTCGAGTTCAGCTCCTTCTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-301s1c1
Sequence:CCGGGAGGTGAACTTCCAGGAGTATCTCGAGATACTCCTGGAAGTTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014624.2-309s1c1
Sequence:CCGGCTTCCAGGAGTATGTCACCTTCTCGAGAAGGTGACATACTCCTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)