EMAIL THIS PAGE TO A FRIEND

S1PR2

sphingosine-1-phosphate receptor 2

47 Gene Product Result for
Synonyms: AGR16 EDG-5 EDG5 Gpcr13 H218 LPB2 S1P2
UniProtKB ID: O95136, Q86UN8
Gene ID:
Human(9294) Summary: This gene encodes a member of the G protein-coupled receptors, as well as the EDG family of proteins. This protein participates in sphingosine 1-phosphate-induced cell proliferation, survival, and transcriptional activation [provided by RefSeq, Jul 2008]
Mouse(14739) sphingosine-1-phosphate receptor 2
Rat(29415) sphingosine-1-phosphate receptor 2
domestic guinea pig(100714153) sphingosine-1-phosphate receptor 2
Domestic Rabbit(100008828) sphingosine-1-phosphate receptor 2
cow(540305) sphingosine-1-phosphate receptor 2
sheep(101112052) sphingosine-1-phosphate receptor 2
Zebrafish(170457) sphingosine-1-phosphate receptor 2
chicken(100857976) sphingosine-1-phosphate receptor 2
dog(484959) sphingosine-1-phosphate receptor 2
domestic cat(101088909) sphingosine-1-phosphate receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S3944 SEW2871 ≥98% (HPLC), solid human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D3439 D-erythro-Dihydrosphingosine 1-phosphate ≥98% (TLC), waxy solid human pricing
S9666 Sphingosine 1-phosphate ≥95%, powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004230 Rosetta Predictions human pricing
NM_017192 Rosetta Predictions rat pricing
NM_010333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080255 predicted 811
2 SASI_Hs01_00080256 predicted 654
3 SASI_Hs02_00337148 predicted 229
4 SASI_Hs01_00080257 predicted 364
5 SASI_Hs02_00337149 predicted 688
6 SASI_Hs01_00080258 predicted 909
7 SASI_Hs01_00080259 predicted 293
8 SASI_Hs01_00080262 predicted 283
9 SASI_Hs01_00080263 predicted 502
10 SASI_Hs01_00080264 predicted 523
11 SASI_Hs01_00080260 predicted 886
12 SASI_Hs01_00080261 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117029 predicted 1404
2 SASI_Rn01_00117030 predicted 1408
3 SASI_Rn01_00117031 predicted 1349
4 SASI_Rn02_00261543 predicted 1652
5 SASI_Rn01_00117032 predicted 1661
6 SASI_Rn01_00117033 predicted 1137
7 SASI_Rn01_00117034 predicted 1703
8 SASI_Rn02_00261544 predicted 1555
9 SASI_Rn02_00261545 predicted 205
10 SASI_Rn01_00117036 predicted 997
11 SASI_Rn01_00117028 predicted 649
12 SASI_Rn01_00117035 predicted 1170
13 SASI_Rn01_00117037 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082880 predicted 1256
2 SASI_Mm01_00082881 predicted 779
3 SASI_Mm01_00082882 predicted 1436
4 SASI_Mm01_00082883 predicted 243
5 SASI_Mm01_00082884 predicted 250
6 SASI_Mm01_00082885 predicted 1514
7 SASI_Mm01_00082886 predicted 1082
8 SASI_Mm01_00082887 predicted 1063
9 SASI_Mm01_00082888 predicted 1494
10 SASI_Mm01_00082889 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004230
S1PR2 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004230.3-819s21c1
Sequence:CCGGCATCGTGCTAGGCGTCTTTATCTCGAGATAAAGACGCCTAGCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004230.3-1494s21c1
Sequence:CCGGACTTTACCACCTGGTACAAAGCTCGAGCTTTGTACCAGGTGGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004230.3-147s21c1
Sequence:CCGGCAAGGTCCAGGAACACTATAACTCGAGTTATAGTGTTCCTGGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-285s1c1
Sequence:CCGGCACTCGGCAATGTACCTGTTTCTCGAGAAACAGGTACATTGCCGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-642s1c1
Sequence:CCGGCCTCTCTACGCCAAGCATTATCTCGAGATAATGCTTGGCGTAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-782s1c1
Sequence:CCGGCCTGCTCAAGACGGTCACCATCTCGAGATGGTGACCGTCTTGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-130s1c1
Sequence:CCGGAGGTCCAGGAACACTATAATTCTCGAGAATTATAGTGTTCCTGGACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-887s1c1
Sequence:CCGGGATCCTCTACAAAGCCCACTACTCGAGTAGTGGGCTTTGTAGAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004230
S1PR2 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004230.3-819s21c1
Sequence:CCGGCATCGTGCTAGGCGTCTTTATCTCGAGATAAAGACGCCTAGCACGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004230.3-1494s21c1
Sequence:CCGGACTTTACCACCTGGTACAAAGCTCGAGCTTTGTACCAGGTGGTAAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004230.3-147s21c1
Sequence:CCGGCAAGGTCCAGGAACACTATAACTCGAGTTATAGTGTTCCTGGACCTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-285s1c1
Sequence:CCGGCACTCGGCAATGTACCTGTTTCTCGAGAAACAGGTACATTGCCGAGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-642s1c1
Sequence:CCGGCCTCTCTACGCCAAGCATTATCTCGAGATAATGCTTGGCGTAGAGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-782s1c1
Sequence:CCGGCCTGCTCAAGACGGTCACCATCTCGAGATGGTGACCGTCTTGAGCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-130s1c1
Sequence:CCGGAGGTCCAGGAACACTATAATTCTCGAGAATTATAGTGTTCCTGGACCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-887s1c1
Sequence:CCGGGATCCTCTACAAAGCCCACTACTCGAGTAGTGGGCTTTGTAGAGGATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004230
S1PR2 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004230.3-819s21c1
Sequence:CCGGCATCGTGCTAGGCGTCTTTATCTCGAGATAAAGACGCCTAGCACGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004230.3-1494s21c1
Sequence:CCGGACTTTACCACCTGGTACAAAGCTCGAGCTTTGTACCAGGTGGTAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004230.3-147s21c1
Sequence:CCGGCAAGGTCCAGGAACACTATAACTCGAGTTATAGTGTTCCTGGACCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-285s1c1
Sequence:CCGGCACTCGGCAATGTACCTGTTTCTCGAGAAACAGGTACATTGCCGAGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-642s1c1
Sequence:CCGGCCTCTCTACGCCAAGCATTATCTCGAGATAATGCTTGGCGTAGAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-782s1c1
Sequence:CCGGCCTGCTCAAGACGGTCACCATCTCGAGATGGTGACCGTCTTGAGCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-130s1c1
Sequence:CCGGAGGTCCAGGAACACTATAATTCTCGAGAATTATAGTGTTCCTGGACCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004230.2-887s1c1
Sequence:CCGGGATCCTCTACAAAGCCCACTACTCGAGTAGTGGGCTTTGTAGAGGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010333
S1PR2 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1056s1c1
Sequence:CCGGCACCCTTAACTCACTGCTCAACTCGAGTTGAGCAGTGAGTTAAGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1251s1c1
Sequence:CCGGACCGACATTTCTGGAGGGTAACTCGAGTTACCCTCCAGAAATGTCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-361s1c1
Sequence:CCGGGCCATCGTGGTGGAGAATCTTCTCGAGAAGATTCTCCACCACGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-774s1c1
Sequence:CCGGGCCTCTCTATGCTAAGCACTACTCGAGTAGTGCTTAGCATAGAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1023s1c1
Sequence:CCGGCCTCTACAAAGCCCACTATTTCTCGAGAAATAGTGGGCTTTGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010333
S1PR2 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1056s1c1
Sequence:CCGGCACCCTTAACTCACTGCTCAACTCGAGTTGAGCAGTGAGTTAAGGGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000028899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1251s1c1
Sequence:CCGGACCGACATTTCTGGAGGGTAACTCGAGTTACCCTCCAGAAATGTCGGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000028917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-361s1c1
Sequence:CCGGGCCATCGTGGTGGAGAATCTTCTCGAGAAGATTCTCCACCACGATGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000028898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-774s1c1
Sequence:CCGGGCCTCTCTATGCTAAGCACTACTCGAGTAGTGCTTAGCATAGAGAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000028883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1023s1c1
Sequence:CCGGCCTCTACAAAGCCCACTATTTCTCGAGAAATAGTGGGCTTTGTAGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010333
S1PR2 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1056s1c1
Sequence:CCGGCACCCTTAACTCACTGCTCAACTCGAGTTGAGCAGTGAGTTAAGGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1251s1c1
Sequence:CCGGACCGACATTTCTGGAGGGTAACTCGAGTTACCCTCCAGAAATGTCGGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-361s1c1
Sequence:CCGGGCCATCGTGGTGGAGAATCTTCTCGAGAAGATTCTCCACCACGATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-774s1c1
Sequence:CCGGGCCTCTCTATGCTAAGCACTACTCGAGTAGTGCTTAGCATAGAGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010333.2-1023s1c1
Sequence:CCGGCCTCTACAAAGCCCACTATTTCTCGAGAAATAGTGGGCTTTGTAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)