EMAIL THIS PAGE TO A FRIEND

S1PR3

sphingosine-1-phosphate receptor 3

46 Gene Product Result for
Synonyms: EDG-3 EDG3 LPB3 S1P3
UniProtKB ID: Q99500, Q5SQD8, Q7Z5I2
Gene ID:
Human(1903) Summary: This gene encodes a member of the EDG family of receptors, which are G protein-coupled receptors. This protein has been identified as a functional receptor for sphingosine 1-phosphate and likely contributes to the regulation of angiogenesis and vascular endothelial cell function. [provided by RefSeq, Jul 2008]
Mouse(13610) sphingosine-1-phosphate receptor 3
Rat(306792) sphingosine-1-phosphate receptor 3
chicken(431264) sphingosine-1-phosphate receptor 3
domestic cat(101095622) sphingosine-1-phosphate receptor 3
dog(484199) sphingosine-1-phosphate receptor 3
cow(539123) sphingosine-1-phosphate receptor 3
sheep(101103373) sphingosine-1-phosphate receptor 3
naked mole-rat(101715716) sphingosine-1-phosphate receptor 3
domestic guinea pig(100730680) sphingosine-1-phosphate receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S3944 SEW2871 ≥98% (HPLC), solid human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D3439 D-erythro-Dihydrosphingosine 1-phosphate ≥98% (TLC), waxy solid human pricing
S9666 Sphingosine 1-phosphate ≥95%, powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035361 MISSION® esiRNA esiRNA targeting mouse S1pr3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005226 Rosetta Predictions human pricing
XM_225216 Rosetta Predictions rat pricing
NM_010101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011116 predicted 1915
2 SASI_Hs01_00011117 predicted 1943
3 SASI_Hs01_00011119 predicted 1732
4 SASI_Hs01_00011120 predicted 924
5 SASI_Hs01_00011121 predicted 1904
6 SASI_Hs01_00011122 predicted 1982
7 SASI_Hs01_00011123 predicted 1071
8 SASI_Hs01_00011124 predicted 687
9 SASI_Hs01_00011125 predicted 1929
10 SASI_Hs02_00339214 predicted 1221
11 SASI_Hs01_00011118 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382647 predicted 843
2 SASI_Rn02_00382648 predicted 537
3 SASI_Rn02_00382649 predicted 910
4 SASI_Rn02_00382650 predicted 429
5 SASI_Rn02_00382651 predicted 689
6 SASI_Rn02_00382652 predicted 517
7 SASI_Rn02_00382653 predicted 968
8 SASI_Rn02_00382654 predicted 999
9 SASI_Rn02_00382655 predicted 800
10 SASI_Rn02_00382656 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145233 predicted 757
2 SASI_Mm01_00145234 predicted 586
3 SASI_Mm01_00145235 predicted 1390
4 SASI_Mm01_00145236 predicted 592
5 SASI_Mm01_00145237 predicted 357
6 SASI_Mm01_00145239 predicted 899
7 SASI_Mm01_00145240 predicted 669
8 SASI_Mm01_00145241 predicted 704
9 SASI_Mm02_00317803 predicted 1225
10 SASI_Mm02_00317804 predicted 1523
11 SASI_Mm01_00145232 predicted 1333
12 SASI_Mm01_00145238 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005226
VALIDATED
S1PR3 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-2741s1c1
Sequence:CCGGGCAGTCTGTTTACCTTGTAAACTCGAGTTTACAAGGTAAACAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-801s1c1
Sequence:CCGGGCGGCACTTGACAATGATCAACTCGAGTTGATCATTGTCAAGTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005226.2-972s1c1
Sequence:CCGGCTCCAAGAAGTACATTGCCTTCTCGAGAAGGCAATGTACTTCTTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-663s1c1
Sequence:CCGGCATCGCTTACAAGGTCAACATCTCGAGATGTTGACCTTGTAAGCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005226.2-1400s1c1
Sequence:CCGGGCAGAAGTAAATCAAGCAGCACTCGAGTGCTGCTTGATTTACTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-1390s21c1
Sequence:CCGGCTCGACCCAAGCAGAAGTAAACTCGAGTTTACTTCTGCTTGGGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-1032s21c1
Sequence:CCGGGATCCTCTACGCACGCATCTACTCGAGTAGATGCGTGCGTAGAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-968s21c1
Sequence:CCGGTCTACTCCAAGAAGTACATTGCTCGAGCAATGTACTTCTTGGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005226
VALIDATED
S1PR3 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-2741s1c1
Sequence:CCGGGCAGTCTGTTTACCTTGTAAACTCGAGTTTACAAGGTAAACAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-801s1c1
Sequence:CCGGGCGGCACTTGACAATGATCAACTCGAGTTGATCATTGTCAAGTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005226.2-972s1c1
Sequence:CCGGCTCCAAGAAGTACATTGCCTTCTCGAGAAGGCAATGTACTTCTTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-663s1c1
Sequence:CCGGCATCGCTTACAAGGTCAACATCTCGAGATGTTGACCTTGTAAGCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005226.2-1400s1c1
Sequence:CCGGGCAGAAGTAAATCAAGCAGCACTCGAGTGCTGCTTGATTTACTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-1390s21c1
Sequence:CCGGCTCGACCCAAGCAGAAGTAAACTCGAGTTTACTTCTGCTTGGGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-1032s21c1
Sequence:CCGGGATCCTCTACGCACGCATCTACTCGAGTAGATGCGTGCGTAGAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-968s21c1
Sequence:CCGGTCTACTCCAAGAAGTACATTGCTCGAGCAATGTACTTCTTGGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005226
VALIDATED
S1PR3 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-2741s1c1
Sequence:CCGGGCAGTCTGTTTACCTTGTAAACTCGAGTTTACAAGGTAAACAGACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-801s1c1
Sequence:CCGGGCGGCACTTGACAATGATCAACTCGAGTTGATCATTGTCAAGTGCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005226.2-972s1c1
Sequence:CCGGCTCCAAGAAGTACATTGCCTTCTCGAGAAGGCAATGTACTTCTTGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005226.2-663s1c1
Sequence:CCGGCATCGCTTACAAGGTCAACATCTCGAGATGTTGACCTTGTAAGCGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005226.2-1400s1c1
Sequence:CCGGGCAGAAGTAAATCAAGCAGCACTCGAGTGCTGCTTGATTTACTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-1390s21c1
Sequence:CCGGCTCGACCCAAGCAGAAGTAAACTCGAGTTTACTTCTGCTTGGGTCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-1032s21c1
Sequence:CCGGGATCCTCTACGCACGCATCTACTCGAGTAGATGCGTGCGTAGAGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005226.2-968s21c1
Sequence:CCGGTCTACTCCAAGAAGTACATTGCTCGAGCAATGTACTTCTTGGAGTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010101
S1PR3 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-899s1c1
Sequence:CCGGCCTCTACTCCAAGAAATACATCTCGAGATGTATTTCTTGGAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-855s21c1
Sequence:CCGGGGAACTGCCTGGAGAACTTTCCTCGAGGAAAGTTCTCCAGGCAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010101.2-3830s1c1
Sequence:CCGGGCCATCTTGTAGATGATGTTACTCGAGTAACATCATCTACAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-596s1c1
Sequence:CCGGCATAGCATACAAGGTCAATATCTCGAGATATTGACCTTGTATGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-380s1c1
Sequence:CCGGCCGGGAACATTACGATTACGTCTCGAGACGTAATCGTAATGTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-595s1c1
Sequence:CCGGGCATAGCATACAAGGTCAATACTCGAGTATTGACCTTGTATGCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-954s21c1
Sequence:CCGGTGACCATCGTCATCTTGTATGCTCGAGCATACAAGATGACGATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-801s21c1
Sequence:CCGGTTGGGATGTGCTGGCTAATTGCTCGAGCAATTAGCCAGCACATCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010101.3-3242s21c1
Sequence:CCGGGGGTCTAGGTCACTGATATTACTCGAGTAATATCAGTGACCTAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-1334s21c1
Sequence:CCGGAGTAAGTCAAGCTCCAGTAACCTCGAGGTTACTGGAGCTTGACTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010101
S1PR3 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-899s1c1
Sequence:CCGGCCTCTACTCCAAGAAATACATCTCGAGATGTATTTCTTGGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-855s21c1
Sequence:CCGGGGAACTGCCTGGAGAACTTTCCTCGAGGAAAGTTCTCCAGGCAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010101.2-3830s1c1
Sequence:CCGGGCCATCTTGTAGATGATGTTACTCGAGTAACATCATCTACAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-596s1c1
Sequence:CCGGCATAGCATACAAGGTCAATATCTCGAGATATTGACCTTGTATGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-380s1c1
Sequence:CCGGCCGGGAACATTACGATTACGTCTCGAGACGTAATCGTAATGTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-595s1c1
Sequence:CCGGGCATAGCATACAAGGTCAATACTCGAGTATTGACCTTGTATGCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-954s21c1
Sequence:CCGGTGACCATCGTCATCTTGTATGCTCGAGCATACAAGATGACGATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-801s21c1
Sequence:CCGGTTGGGATGTGCTGGCTAATTGCTCGAGCAATTAGCCAGCACATCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010101.3-3242s21c1
Sequence:CCGGGGGTCTAGGTCACTGATATTACTCGAGTAATATCAGTGACCTAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-1334s21c1
Sequence:CCGGAGTAAGTCAAGCTCCAGTAACCTCGAGGTTACTGGAGCTTGACTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010101
S1PR3 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-899s1c1
Sequence:CCGGCCTCTACTCCAAGAAATACATCTCGAGATGTATTTCTTGGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-855s21c1
Sequence:CCGGGGAACTGCCTGGAGAACTTTCCTCGAGGAAAGTTCTCCAGGCAGTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010101.2-3830s1c1
Sequence:CCGGGCCATCTTGTAGATGATGTTACTCGAGTAACATCATCTACAAGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-596s1c1
Sequence:CCGGCATAGCATACAAGGTCAATATCTCGAGATATTGACCTTGTATGCTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-380s1c1
Sequence:CCGGCCGGGAACATTACGATTACGTCTCGAGACGTAATCGTAATGTTCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010101.2-595s1c1
Sequence:CCGGGCATAGCATACAAGGTCAATACTCGAGTATTGACCTTGTATGCTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-954s21c1
Sequence:CCGGTGACCATCGTCATCTTGTATGCTCGAGCATACAAGATGACGATGGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-801s21c1
Sequence:CCGGTTGGGATGTGCTGGCTAATTGCTCGAGCAATTAGCCAGCACATCCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010101.3-3242s21c1
Sequence:CCGGGGGTCTAGGTCACTGATATTACTCGAGTAATATCAGTGACCTAGACCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010101.3-1334s21c1
Sequence:CCGGAGTAAGTCAAGCTCCAGTAACCTCGAGGTTACTGGAGCTTGACTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)