EMAIL THIS PAGE TO A FRIEND

S1PR4

sphingosine-1-phosphate receptor 4

50 Gene Product Result for
Synonyms: EDG6 LPC1 S1P4 SLP4
UniProtKB ID: O95977, D6W612
Gene ID:
Human(8698) Summary: This gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. EDG receptors bind lysophospholipids or lysosphingolipids as ligands, and are involved in cell signalling in many different cell types. This EDG receptor gene is intronless and is specifically expressed in the lymphoid tissue. [provided by RefSeq, Jul 2008]
Mouse(13611) sphingosine-1-phosphate receptor 4
Rat(314649) sphingosine-1-phosphate receptor 4
Zebrafish(402857) sphingosine-1-phosphate receptor 4
chicken(430495) sphingosine-1-phosphate receptor 4
domestic cat(101083490) sphingosine-1-phosphate receptor 4
dog(612082) sphingosine-1-phosphate receptor 4
naked mole-rat(101721587) sphingosine-1-phosphate receptor 4
cow(539534) sphingosine-1-phosphate receptor 4
sheep(101118697) sphingosine-1-phosphate receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S3944 SEW2871 ≥98% (HPLC), solid human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D3439 D-erythro-Dihydrosphingosine 1-phosphate ≥98% (TLC), waxy solid human pricing
S9666 Sphingosine 1-phosphate ≥95%, powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142481 MISSION® esiRNA targeting human S1PR4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003775 Rosetta Predictions human pricing
NM_001108075 Rosetta Predictions rat pricing
NM_010102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246600 predicted 581
2 SASI_Hs01_00246601 predicted 904
3 SASI_Hs02_00336271 predicted 840
4 SASI_Hs01_00246602 predicted 1152
5 SASI_Hs01_00246603 predicted 769
6 SASI_Hs01_00246605 predicted 1065
7 SASI_Hs01_00246606 predicted 575
8 SASI_Hs01_00246607 predicted 506
9 SASI_Hs01_00246608 predicted 556
10 SASI_Hs01_00246609 predicted 1169
11 SASI_Hs01_00246604 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235104 predicted 1283
2 SASI_Rn02_00235105 predicted 1020
3 SASI_Rn02_00235106 predicted 1035
4 SASI_Rn02_00235107 predicted 1398
5 SASI_Rn02_00235108 predicted 1887
6 SASI_Rn02_00235109 predicted 1800
7 SASI_Rn02_00235110 predicted 1479
8 SASI_Rn02_00235111 predicted 1304
9 SASI_Rn02_00235112 predicted 1938
10 SASI_Rn02_00235113 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094192 predicted 760
2 SASI_Mm01_00094193 predicted 1318
3 SASI_Mm01_00094195 predicted 1398
4 SASI_Mm01_00094196 predicted 1384
5 SASI_Mm01_00094197 predicted 744
6 SASI_Mm01_00094198 predicted 799
7 SASI_Mm01_00094199 predicted 815
8 SASI_Mm01_00094200 predicted 1249
9 SASI_Mm01_00094201 predicted 963
10 SASI_Mm02_00317805 predicted 1229
11 SASI_Mm01_00094194 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003775
S1PR4 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-846s21c1
Sequence:CCGGACGTCTTTGGCTCCAACCTCTCTCGAGAGAGGTTGGAGCCAAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-95s21c1
Sequence:CCGGCTCATTGTTCTGCACTACAACCTCGAGGTTGTAGTGCAGAACAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-619s21c1
Sequence:CCGGCCTCTACTCCAAGCGCTACATCTCGAGATGTAGCGCTTGGAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-766s1c1
Sequence:CCGGCCTGCTGAAGACGGTGCTGATCTCGAGATCAGCACCGTCTTCAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-279s21c1
Sequence:CCGGTGGTGAACATCACGCTGAGTGCTCGAGCACTCAGCGTGATGTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003775.1-1356s1c1
Sequence:CCGGGTCACCCTGGACAAGGAGGTACTCGAGTACCTCCTTGTCCAGGGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-91s1c1
Sequence:CCGGGCTCATTGTTCTGCACTACAACTCGAGTTGTAGTGCAGAACAATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-910s1c1
Sequence:CCGGCGTCCTCAACTCGGCGGTCAACTCGAGTTGACCGCCGAGTTGAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-265s1c1
Sequence:CCGGCTACTATTGCCTGGTGAACATCTCGAGATGTTCACCAGGCAATAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003775
S1PR4 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-846s21c1
Sequence:CCGGACGTCTTTGGCTCCAACCTCTCTCGAGAGAGGTTGGAGCCAAAGACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-95s21c1
Sequence:CCGGCTCATTGTTCTGCACTACAACCTCGAGGTTGTAGTGCAGAACAATGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-619s21c1
Sequence:CCGGCCTCTACTCCAAGCGCTACATCTCGAGATGTAGCGCTTGGAGTAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-766s1c1
Sequence:CCGGCCTGCTGAAGACGGTGCTGATCTCGAGATCAGCACCGTCTTCAGCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000367736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-279s21c1
Sequence:CCGGTGGTGAACATCACGCTGAGTGCTCGAGCACTCAGCGTGATGTTCACCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003775.1-1356s1c1
Sequence:CCGGGTCACCCTGGACAAGGAGGTACTCGAGTACCTCCTTGTCCAGGGTGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-91s1c1
Sequence:CCGGGCTCATTGTTCTGCACTACAACTCGAGTTGTAGTGCAGAACAATGAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-910s1c1
Sequence:CCGGCGTCCTCAACTCGGCGGTCAACTCGAGTTGACCGCCGAGTTGAGGACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-265s1c1
Sequence:CCGGCTACTATTGCCTGGTGAACATCTCGAGATGTTCACCAGGCAATAGTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003775
S1PR4 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-846s21c1
Sequence:CCGGACGTCTTTGGCTCCAACCTCTCTCGAGAGAGGTTGGAGCCAAAGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-95s21c1
Sequence:CCGGCTCATTGTTCTGCACTACAACCTCGAGGTTGTAGTGCAGAACAATGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-619s21c1
Sequence:CCGGCCTCTACTCCAAGCGCTACATCTCGAGATGTAGCGCTTGGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-766s1c1
Sequence:CCGGCCTGCTGAAGACGGTGCTGATCTCGAGATCAGCACCGTCTTCAGCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003775.2-279s21c1
Sequence:CCGGTGGTGAACATCACGCTGAGTGCTCGAGCACTCAGCGTGATGTTCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003775.1-1356s1c1
Sequence:CCGGGTCACCCTGGACAAGGAGGTACTCGAGTACCTCCTTGTCCAGGGTGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-91s1c1
Sequence:CCGGGCTCATTGTTCTGCACTACAACTCGAGTTGTAGTGCAGAACAATGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-910s1c1
Sequence:CCGGCGTCCTCAACTCGGCGGTCAACTCGAGTTGACCGCCGAGTTGAGGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003775.1-265s1c1
Sequence:CCGGCTACTATTGCCTGGTGAACATCTCGAGATGTTCACCAGGCAATAGTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010102
S1PR4 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1322s1c1
Sequence:CCGGGCTGACATCTTTGGTTCTAATCTCGAGATTAGAACCAAAGATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1402s1c1
Sequence:CCGGCTCAGCCATTAATCCTCTCATCTCGAGATGAGAGGATTAATGGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1404s1c1
Sequence:CCGGCAGCCATTAATCCTCTCATCTCTCGAGAGATGAGAGGATTAATGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-575s1c1
Sequence:CCGGCTCATTGTCCTGCACTACAATCTCGAGATTGTAGTGCAGGACAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1394s1c1
Sequence:CCGGGTGTTCAACTCAGCCATTAATCTCGAGATTAATGGCTGAGTTGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010102
S1PR4 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1322s1c1
Sequence:CCGGGCTGACATCTTTGGTTCTAATCTCGAGATTAGAACCAAAGATGTCAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1402s1c1
Sequence:CCGGCTCAGCCATTAATCCTCTCATCTCGAGATGAGAGGATTAATGGCTGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1404s1c1
Sequence:CCGGCAGCCATTAATCCTCTCATCTCTCGAGAGATGAGAGGATTAATGGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-575s1c1
Sequence:CCGGCTCATTGTCCTGCACTACAATCTCGAGATTGTAGTGCAGGACAATGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000176085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1394s1c1
Sequence:CCGGGTGTTCAACTCAGCCATTAATCTCGAGATTAATGGCTGAGTTGAACACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010102
S1PR4 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1322s1c1
Sequence:CCGGGCTGACATCTTTGGTTCTAATCTCGAGATTAGAACCAAAGATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1402s1c1
Sequence:CCGGCTCAGCCATTAATCCTCTCATCTCGAGATGAGAGGATTAATGGCTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1404s1c1
Sequence:CCGGCAGCCATTAATCCTCTCATCTCTCGAGAGATGAGAGGATTAATGGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-575s1c1
Sequence:CCGGCTCATTGTCCTGCACTACAATCTCGAGATTGTAGTGCAGGACAATGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010102.1-1394s1c1
Sequence:CCGGGTGTTCAACTCAGCCATTAATCTCGAGATTAATGGCTGAGTTGAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)