EMAIL THIS PAGE TO A FRIEND

S1PR5

sphingosine-1-phosphate receptor 5

48 Gene Product Result for
Synonyms: EDG8 Edg-8 S1P5 SPPR-1 SPPR-2
UniProtKB ID: Q9H228, Q6NW11
Gene ID:
Human(53637) Summary: The lysosphingolipid sphingosine 1-phosphate (S1P) regulates cell proliferation, apoptosis, motility, and neurite retraction. Its actions may be both intracellular as a second messenger and extracellular as a receptor ligand. S1P and the structurally related lysolipid mediator lysophosphatidic acid (LPA) signal cells through a set of G protein-coupled receptors known as EDG receptors. Some EDG receptors (e.g., EDG1; MIM 601974) are S1P receptors; others (e.g., EDG2; MIM 602282) are LPA receptors.[supplied by OMIM, Mar 2008]
Mouse(94226) sphingosine-1-phosphate receptor 5
Rat(60399) sphingosine-1-phosphate receptor 5
cow(517533) sphingosine-1-phosphate receptor 5
sheep(101117761) sphingosine-1-phosphate receptor 5
dog(610828) sphingosine-1-phosphate receptor 5
domestic cat(101091512) sphingosine-1-phosphate receptor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S3944 SEW2871 ≥98% (HPLC), solid human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D3439 D-erythro-Dihydrosphingosine 1-phosphate ≥98% (TLC), waxy solid human pricing
S9666 Sphingosine 1-phosphate ≥95%, powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030760 Rosetta Predictions human pricing
NM_021775 Rosetta Predictions rat pricing
NM_053190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189818 predicted 600
2 SASI_Hs01_00189819 predicted 609
3 SASI_Hs01_00189821 predicted 406
4 SASI_Hs01_00189822 predicted 677
5 SASI_Hs01_00189823 predicted 695
6 SASI_Hs01_00189824 predicted 290
7 SASI_Hs01_00189825 predicted 197
8 SASI_Hs01_00189826 predicted 290
9 SASI_Hs01_00189827 predicted 391
10 SASI_Hs02_00358282 predicted 215
11 SASI_Hs01_00189820 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076712 predicted 1660
2 SASI_Rn01_00076713 predicted 1844
3 SASI_Rn01_00076714 predicted 1651
4 SASI_Rn01_00076715 predicted 805
5 SASI_Rn01_00076716 predicted 1052
6 SASI_Rn01_00076717 predicted 1872
7 SASI_Rn01_00076718 predicted 1240
8 SASI_Rn01_00076719 predicted 296
9 SASI_Rn01_00076720 predicted 1012
10 SASI_Rn01_00076721 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027323 predicted 1832
2 SASI_Mm01_00027324 predicted 314
3 SASI_Mm01_00027325 predicted 1524
4 SASI_Mm01_00027327 predicted 1716
5 SASI_Mm01_00027328 predicted 668
6 SASI_Mm01_00027329 predicted 1970
7 SASI_Mm01_00027330 predicted 1802
8 SASI_Mm01_00027332 predicted 1517
9 SASI_Mm02_00337759 predicted 1826
10 SASI_Mm02_00337760 predicted 472
11 SASI_Mm01_00027326 predicted 1005
12 SASI_Mm01_00027331 predicted 1704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030760
S1PR5 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-151s1c1
Sequence:CCGGGCCTTCATCGTGCTAGAGAATCTCGAGATTCTCTAGCACGATGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-1171s1c1
Sequence:CCGGGCCCGGACTCTGGTATCAGAACTCGAGTTCTGATACCAGAGTCCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030760.3-93s21c1
Sequence:CCGGCGAGGTCATCGTCCTGCATTACTCGAGTAATGCAGGACGATGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030760.2-1414s1c1
Sequence:CCGGCGGTGATGAAATAATGGAGATCTCGAGATCTCCATTATTTCATCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-162s1c1
Sequence:CCGGGCTAGAGAATCTAGCCGTGTTCTCGAGAACACGGCTAGATTCTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-918s1c1
Sequence:CCGGCATCATCTACACGCTCACCAACTCGAGTTGGTGAGCGTGTAGATGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030760.3-1746s21c1
Sequence:CCGGAGGACCTTGTGGGTGATATAGCTCGAGCTATATCACCCACAAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030760
S1PR5 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-151s1c1
Sequence:CCGGGCCTTCATCGTGCTAGAGAATCTCGAGATTCTCTAGCACGATGAAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000004750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-1171s1c1
Sequence:CCGGGCCCGGACTCTGGTATCAGAACTCGAGTTCTGATACCAGAGTCCGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030760.3-93s21c1
Sequence:CCGGCGAGGTCATCGTCCTGCATTACTCGAGTAATGCAGGACGATGACCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000004748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030760.2-1414s1c1
Sequence:CCGGCGGTGATGAAATAATGGAGATCTCGAGATCTCCATTATTTCATCACCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000004751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-162s1c1
Sequence:CCGGGCTAGAGAATCTAGCCGTGTTCTCGAGAACACGGCTAGATTCTCTAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000004752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-918s1c1
Sequence:CCGGCATCATCTACACGCTCACCAACTCGAGTTGGTGAGCGTGTAGATGATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030760.3-1746s21c1
Sequence:CCGGAGGACCTTGTGGGTGATATAGCTCGAGCTATATCACCCACAAGGTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030760
S1PR5 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-151s1c1
Sequence:CCGGGCCTTCATCGTGCTAGAGAATCTCGAGATTCTCTAGCACGATGAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-1171s1c1
Sequence:CCGGGCCCGGACTCTGGTATCAGAACTCGAGTTCTGATACCAGAGTCCGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030760.3-93s21c1
Sequence:CCGGCGAGGTCATCGTCCTGCATTACTCGAGTAATGCAGGACGATGACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030760.2-1414s1c1
Sequence:CCGGCGGTGATGAAATAATGGAGATCTCGAGATCTCCATTATTTCATCACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-162s1c1
Sequence:CCGGGCTAGAGAATCTAGCCGTGTTCTCGAGAACACGGCTAGATTCTCTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030760.2-918s1c1
Sequence:CCGGCATCATCTACACGCTCACCAACTCGAGTTGGTGAGCGTGTAGATGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030760.3-1746s21c1
Sequence:CCGGAGGACCTTGTGGGTGATATAGCTCGAGCTATATCACCCACAAGGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053190
S1PR5 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-1173s21c1
Sequence:CCGGTGGCTAACTCGCTGCTGAATCCTCGAGGATTCAGCAGCGAGTTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-1289s1c1
Sequence:CCGGCGCAGCTCTAGCCCATCAGAACTCGAGTTCTGATGGGCTAGAGCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-413s1c1
Sequence:CCGGGCGCCCATGTTTCTGCTCCTTCTCGAGAAGGAGCAGAAACATGGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-1082s21c1
Sequence:CCGGCCGCTGTTTCTCTTGCTATTACTCGAGTAATAGCAAGAGAAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-310s21c1
Sequence:CCGGGCCGGTGAGTGAGGTTATTGTCTCGAGACAATAACCTCACTCACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-834s1c1
Sequence:CCGGGTGCGCTCTATGCAAGGATTTCTCGAGAAATCCTTGCATAGAGCGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-547s21c1
Sequence:CCGGCTACGCCACCAACATCCTACTCTCGAGAGTAGGATGTTGGTGGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053190.2-1969s21c1
Sequence:CCGGACCAGGTGATGTCTAGATAAGCTCGAGCTTATCTAGACATCACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053190
S1PR5 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-1173s21c1
Sequence:CCGGTGGCTAACTCGCTGCTGAATCCTCGAGGATTCAGCAGCGAGTTAGCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000004672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-1289s1c1
Sequence:CCGGCGCAGCTCTAGCCCATCAGAACTCGAGTTCTGATGGGCTAGAGCTGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-413s1c1
Sequence:CCGGGCGCCCATGTTTCTGCTCCTTCTCGAGAAGGAGCAGAAACATGGGCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000365926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-1082s21c1
Sequence:CCGGCCGCTGTTTCTCTTGCTATTACTCGAGTAATAGCAAGAGAAACAGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000376675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-310s21c1
Sequence:CCGGGCCGGTGAGTGAGGTTATTGTCTCGAGACAATAACCTCACTCACCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000004671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-834s1c1
Sequence:CCGGGTGCGCTCTATGCAAGGATTTCTCGAGAAATCCTTGCATAGAGCGCACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000374011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-547s21c1
Sequence:CCGGCTACGCCACCAACATCCTACTCTCGAGAGTAGGATGTTGGTGGCGTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000365836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053190.2-1969s21c1
Sequence:CCGGACCAGGTGATGTCTAGATAAGCTCGAGCTTATCTAGACATCACCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053190
S1PR5 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-1173s21c1
Sequence:CCGGTGGCTAACTCGCTGCTGAATCCTCGAGGATTCAGCAGCGAGTTAGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-1289s1c1
Sequence:CCGGCGCAGCTCTAGCCCATCAGAACTCGAGTTCTGATGGGCTAGAGCTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-413s1c1
Sequence:CCGGGCGCCCATGTTTCTGCTCCTTCTCGAGAAGGAGCAGAAACATGGGCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-1082s21c1
Sequence:CCGGCCGCTGTTTCTCTTGCTATTACTCGAGTAATAGCAAGAGAAACAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-310s21c1
Sequence:CCGGGCCGGTGAGTGAGGTTATTGTCTCGAGACAATAACCTCACTCACCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053190.1-834s1c1
Sequence:CCGGGTGCGCTCTATGCAAGGATTTCTCGAGAAATCCTTGCATAGAGCGCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053190.2-547s21c1
Sequence:CCGGCTACGCCACCAACATCCTACTCTCGAGAGTAGGATGTTGGTGGCGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053190.2-1969s21c1
Sequence:CCGGACCAGGTGATGTCTAGATAAGCTCGAGCTTATCTAGACATCACCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)