EMAIL THIS PAGE TO A FRIEND

SAMD10

sterile alpha motif domain containing 10

47 Gene Product Result for
Synonyms: C20orf136 dJ591C20 dJ591C20.7
UniProtKB ID: Q9BYL1
Gene ID:
Mouse(229011) sterile alpha motif domain containing 10
Rat(499957) sterile alpha motif domain containing 10
naked mole-rat(101703909) sterile alpha motif domain containing 10
domestic guinea pig(100727736) sterile alpha motif domain containing 10
cow(540999) sterile alpha motif domain containing 10
sheep(101116077) sterile alpha motif domain containing 10
chicken(428153) sterile alpha motif domain containing 10
domestic cat(101091525) sterile alpha motif domain containing 10
dog(612565) sterile alpha motif domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040973 Anti-SAMD10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080621 Rosetta Predictions human pricing
XM_001057159 Rosetta Predictions rat pricing
XM_575305 Rosetta Predictions rat pricing
NM_172676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117769 predicted 1130
2 SASI_Hs01_00117770 predicted 446
3 SASI_Hs01_00117771 predicted 535
4 SASI_Hs02_00362367 predicted 586
5 SASI_Hs01_00117768 predicted 754
6 SASI_Hs01_00117773 predicted 1112
7 SASI_Hs02_00362368 predicted 634
8 SASI_Hs01_00117774 predicted 1115
9 SASI_Hs01_00117775 predicted 772
10 SASI_Hs01_00117776 predicted 540
11 SASI_Hs01_00117772 predicted 461
12 SASI_Hs01_00117777 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285616 predicted 842
2 SASI_Rn02_00285617 predicted 1261
3 SASI_Rn02_00285618 predicted 1339
4 SASI_Rn02_00285619 predicted 1450
5 SASI_Rn02_00285620 predicted 1048
6 SASI_Rn02_00285621 predicted 1443
7 SASI_Rn02_00285622 predicted 722
8 SASI_Rn02_00285623 predicted 577
9 SASI_Rn02_00285624 predicted 1137
10 SASI_Rn02_00285625 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403468 predicted 841
2 SASI_Rn02_00403469 predicted 1260
3 SASI_Rn02_00403470 predicted 1339
4 SASI_Rn02_00403471 predicted 1446
5 SASI_Rn02_00403472 predicted 1050
6 SASI_Rn02_00403473 predicted 1443
7 SASI_Rn02_00403474 predicted 721
8 SASI_Rn02_00403475 predicted 578
9 SASI_Rn02_00403476 predicted 1140
10 SASI_Rn02_00403477 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034944 predicted 727
2 SASI_Mm01_00034945 predicted 822
3 SASI_Mm01_00034946 predicted 934
4 SASI_Mm01_00034947 predicted 473
5 SASI_Mm01_00034948 predicted 824
6 SASI_Mm01_00034949 predicted 253
7 SASI_Mm01_00034950 predicted 510
8 SASI_Mm01_00034951 predicted 1193
9 SASI_Mm01_00034952 predicted 461
10 SASI_Mm01_00034953 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080621
SAMD10 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080621.4-1362s21c1
Sequence:CCGGCCAAGCACTTTCATCATTATTCTCGAGAATAATGATGAAAGTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-541s21c1
Sequence:CCGGCGTCTGCAAGTGGCTCAAGAACTCGAGTTCTTGAGCCACTTGCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080621.3-1359s1c1
Sequence:CCGGCCAAGCACTTTCATCATTATTCTCGAGAATAATGATGAAAGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-453s21c1
Sequence:CCGGGGCTGTACTCTGACCACTATGCTCGAGCATAGTGGTCAGAGTACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-571s21c1
Sequence:CCGGCCACAACTACCTCGTCTACGTCTCGAGACGTAGACGAGGTAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080621.3-1305s1c1
Sequence:CCGGGCCAACCCATCATCTAGAGTACTCGAGTACTCTAGATGATGGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-755s21c1
Sequence:CCGGAGCCAAGCTTCCTTCGGGAAACTCGAGTTTCCCGAAGGAAGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080621
SAMD10 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080621.4-1362s21c1
Sequence:CCGGCCAAGCACTTTCATCATTATTCTCGAGAATAATGATGAAAGTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-541s21c1
Sequence:CCGGCGTCTGCAAGTGGCTCAAGAACTCGAGTTCTTGAGCCACTTGCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080621.3-1359s1c1
Sequence:CCGGCCAAGCACTTTCATCATTATTCTCGAGAATAATGATGAAAGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-453s21c1
Sequence:CCGGGGCTGTACTCTGACCACTATGCTCGAGCATAGTGGTCAGAGTACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-571s21c1
Sequence:CCGGCCACAACTACCTCGTCTACGTCTCGAGACGTAGACGAGGTAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080621.3-1305s1c1
Sequence:CCGGGCCAACCCATCATCTAGAGTACTCGAGTACTCTAGATGATGGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-755s21c1
Sequence:CCGGAGCCAAGCTTCCTTCGGGAAACTCGAGTTTCCCGAAGGAAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080621
SAMD10 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080621.4-1362s21c1
Sequence:CCGGCCAAGCACTTTCATCATTATTCTCGAGAATAATGATGAAAGTGCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-541s21c1
Sequence:CCGGCGTCTGCAAGTGGCTCAAGAACTCGAGTTCTTGAGCCACTTGCAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080621.3-1359s1c1
Sequence:CCGGCCAAGCACTTTCATCATTATTCTCGAGAATAATGATGAAAGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-453s21c1
Sequence:CCGGGGCTGTACTCTGACCACTATGCTCGAGCATAGTGGTCAGAGTACAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-571s21c1
Sequence:CCGGCCACAACTACCTCGTCTACGTCTCGAGACGTAGACGAGGTAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080621.3-1305s1c1
Sequence:CCGGGCCAACCCATCATCTAGAGTACTCGAGTACTCTAGATGATGGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080621.4-755s21c1
Sequence:CCGGAGCCAAGCTTCCTTCGGGAAACTCGAGTTTCCCGAAGGAAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172676
SAMD10 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-476s21c1
Sequence:CCGGGTGGAGCCAACAAGACGTTTGCTCGAGCAAACGTCTTGTTGGCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-506s1c1
Sequence:CCGGCAAGAAGCATTGTCCTCACAACTCGAGTTGTGAGGACAATGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-481s1c1
Sequence:CCGGGCCAACAAGACGTTTGCAAGTCTCGAGACTTGCAAACGTCTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-581s1c1
Sequence:CCGGGCTTCGACTGAATGCAGATAACTCGAGTTATCTGCATTCAGTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-581s21c1
Sequence:CCGGGCTTCGACTGAATGCAGATAACTCGAGTTATCTGCATTCAGTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172676.2-1307s21c1
Sequence:CCGGTGATTATGAAACGTCAGTATACTCGAGTATACTGACGTTTCATAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-259s21c1
Sequence:CCGGCAGTATCAGCTGAGAACATACCTCGAGGTATGTTCTCAGCTGATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172676.2-948s1c1
Sequence:CCGGGCCTGCTTATAGACCCTTCTTCTCGAGAAGAAGGGTCTATAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-727s21c1
Sequence:CCGGTGTCCTAGCTGCTGCCTATACCTCGAGGTATAGGCAGCAGCTAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172676
SAMD10 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-476s21c1
Sequence:CCGGGTGGAGCCAACAAGACGTTTGCTCGAGCAAACGTCTTGTTGGCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-506s1c1
Sequence:CCGGCAAGAAGCATTGTCCTCACAACTCGAGTTGTGAGGACAATGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-481s1c1
Sequence:CCGGGCCAACAAGACGTTTGCAAGTCTCGAGACTTGCAAACGTCTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-581s1c1
Sequence:CCGGGCTTCGACTGAATGCAGATAACTCGAGTTATCTGCATTCAGTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-581s21c1
Sequence:CCGGGCTTCGACTGAATGCAGATAACTCGAGTTATCTGCATTCAGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172676.2-1307s21c1
Sequence:CCGGTGATTATGAAACGTCAGTATACTCGAGTATACTGACGTTTCATAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-259s21c1
Sequence:CCGGCAGTATCAGCTGAGAACATACCTCGAGGTATGTTCTCAGCTGATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172676.2-948s1c1
Sequence:CCGGGCCTGCTTATAGACCCTTCTTCTCGAGAAGAAGGGTCTATAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-727s21c1
Sequence:CCGGTGTCCTAGCTGCTGCCTATACCTCGAGGTATAGGCAGCAGCTAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172676
SAMD10 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-476s21c1
Sequence:CCGGGTGGAGCCAACAAGACGTTTGCTCGAGCAAACGTCTTGTTGGCTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-506s1c1
Sequence:CCGGCAAGAAGCATTGTCCTCACAACTCGAGTTGTGAGGACAATGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-481s1c1
Sequence:CCGGGCCAACAAGACGTTTGCAAGTCTCGAGACTTGCAAACGTCTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172676.2-581s1c1
Sequence:CCGGGCTTCGACTGAATGCAGATAACTCGAGTTATCTGCATTCAGTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-581s21c1
Sequence:CCGGGCTTCGACTGAATGCAGATAACTCGAGTTATCTGCATTCAGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172676.2-1307s21c1
Sequence:CCGGTGATTATGAAACGTCAGTATACTCGAGTATACTGACGTTTCATAATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-259s21c1
Sequence:CCGGCAGTATCAGCTGAGAACATACCTCGAGGTATGTTCTCAGCTGATACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172676.2-948s1c1
Sequence:CCGGGCCTGCTTATAGACCCTTCTTCTCGAGAAGAAGGGTCTATAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172676.2-727s21c1
Sequence:CCGGTGTCCTAGCTGCTGCCTATACCTCGAGGTATAGGCAGCAGCTAGGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)