EMAIL THIS PAGE TO A FRIEND

SAMD11

sterile alpha motif domain containing 11

44 Gene Product Result for
Gene ID:
Mouse(231004) sterile alpha motif domain containing 11
Rat(313778) sterile alpha motif domain containing 11
Zebrafish(569122) sterile alpha motif domain containing 11
chicken(419434) sterile alpha motif domain containing 11
domestic cat(101081455) sterile alpha motif domain containing 11
Horse(100061572) sterile alpha motif domain containing 11
dog(479576) sterile alpha motif domain containing 11
cow(100140500) sterile alpha motif domain containing 11
sheep(101108327) sterile alpha motif domain containing 11
domestic guinea pig(100732705) sterile alpha motif domain containing 11
naked mole-rat(101697811) sterile alpha motif domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001110516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127081 MISSION® esiRNA targeting human SAMD11 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152486 Rosetta Predictions human pricing
XM_001078401 Rosetta Predictions rat pricing
XM_233727 Rosetta Predictions rat pricing
NM_001110516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366262 predicted 308
2 SASI_Hs01_00017354 predicted 1735
3 SASI_Hs01_00017356 predicted 1957
4 SASI_Hs01_00017357 predicted 388
5 SASI_Hs01_00017358 predicted 295
6 SASI_Hs01_00017359 predicted 296
7 SASI_Hs01_00017360 predicted 432
8 SASI_Hs01_00017361 predicted 2068
9 SASI_Hs01_00017362 predicted 392
10 SASI_Hs01_00017363 predicted 965
11 SASI_Hs01_00017355 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360634 predicted 1677
2 SASI_Rn02_00360635 predicted 1490
3 SASI_Rn02_00360636 predicted 1690
4 SASI_Rn02_00360637 predicted 1173
5 SASI_Rn02_00360638 predicted 479
6 SASI_Rn02_00360639 predicted 1617
7 SASI_Rn02_00360640 predicted 979
8 SASI_Rn02_00360641 predicted 349
9 SASI_Rn02_00360642 predicted 1627
10 SASI_Rn02_00360643 predicted 1691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387980 predicted 1245
2 SASI_Rn02_00387981 predicted 1292
3 SASI_Rn02_00387982 predicted 1078
4 SASI_Rn02_00387983 predicted 378
5 SASI_Rn02_00387984 predicted 255
6 SASI_Rn02_00387985 predicted 1264
7 SASI_Rn02_00387986 predicted 1289
8 SASI_Rn02_00387987 predicted 1302
9 SASI_Rn02_00387988 predicted 1168
10 SASI_Rn02_00387989 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305648 predicted 462
2 SASI_Mm02_00305649 predicted 661
3 SASI_Mm02_00305650 predicted 1778
4 SASI_Mm02_00305651 predicted 477
5 SASI_Mm02_00305652 predicted 1461
6 SASI_Mm02_00305653 predicted 1288
7 SASI_Mm02_00305654 predicted 1514
8 SASI_Mm02_00305655 predicted 1837
9 SASI_Mm02_00305656 predicted 213
10 SASI_Mm02_00305657 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110516
SAMD11 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 11
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000376949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110516.1-1874s21c1
Sequence:CCGGTCCGTGATTCCCAGTCAAATTCTCGAGAATTTGACTGGGAATCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110516.1-1480s21c1
Sequence:CCGGTGGCGAGTATGCCAGGGTATTCTCGAGAATACCCTGGCATACTCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110516.1-1491s21c1
Sequence:CCGGCCAGGGTATTCGGAGAACAAGCTCGAGCTTGTTCTCCGAATACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110516
SAMD11 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 11
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000376949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110516.1-1874s21c1
Sequence:CCGGTCCGTGATTCCCAGTCAAATTCTCGAGAATTTGACTGGGAATCACGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110516.1-1480s21c1
Sequence:CCGGTGGCGAGTATGCCAGGGTATTCTCGAGAATACCCTGGCATACTCGCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110516.1-1491s21c1
Sequence:CCGGCCAGGGTATTCGGAGAACAAGCTCGAGCTTGTTCTCCGAATACCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110516
SAMD11 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 11
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000376949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110516.1-1874s21c1
Sequence:CCGGTCCGTGATTCCCAGTCAAATTCTCGAGAATTTGACTGGGAATCACGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110516.1-1480s21c1
Sequence:CCGGTGGCGAGTATGCCAGGGTATTCTCGAGAATACCCTGGCATACTCGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110516.1-1491s21c1
Sequence:CCGGCCAGGGTATTCGGAGAACAAGCTCGAGCTTGTTCTCCGAATACCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152486
VALIDATED
SAMD11 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152486.2-2200s1c1
Sequence:CCGGCCGCTTTATTTCTTTCGGTTTCTCGAGAAACCGAAAGAAATAAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152486.2-348s21c1
Sequence:CCGGTGGGACGTGAACATCTCTTTCCTCGAGGAAAGAGATGTTCACGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152486.2-2166s21c1
Sequence:CCGGGAGCCACCACTCAACACAATGCTCGAGCATTGTGTTGAGTGGTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152486.2-317s1c1
Sequence:CCGGCCGTATCATGAAGAGAAGAGTCTCGAGACTCTTCTCTTCATGATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152486.2-1756s21c1
Sequence:CCGGGAGAGTACACTCGGGTCTTCACTCGAGTGAAGACCCGAGTGTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152486.2-394s21c1
Sequence:CCGGGCAACCTTCCCACCCTCATATCTCGAGATATGAGGGTGGGAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152486.2-307s21c1
Sequence:CCGGGTCCGCACATCCGTATCATGACTCGAGTCATGATACGGATGTGCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152486
VALIDATED
SAMD11 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152486.2-2200s1c1
Sequence:CCGGCCGCTTTATTTCTTTCGGTTTCTCGAGAAACCGAAAGAAATAAAGCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152486.2-348s21c1
Sequence:CCGGTGGGACGTGAACATCTCTTTCCTCGAGGAAAGAGATGTTCACGTCCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152486.2-2166s21c1
Sequence:CCGGGAGCCACCACTCAACACAATGCTCGAGCATTGTGTTGAGTGGTGGCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152486.2-317s1c1
Sequence:CCGGCCGTATCATGAAGAGAAGAGTCTCGAGACTCTTCTCTTCATGATACGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152486.2-1756s21c1
Sequence:CCGGGAGAGTACACTCGGGTCTTCACTCGAGTGAAGACCCGAGTGTACTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152486.2-394s21c1
Sequence:CCGGGCAACCTTCCCACCCTCATATCTCGAGATATGAGGGTGGGAAGGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152486.2-307s21c1
Sequence:CCGGGTCCGCACATCCGTATCATGACTCGAGTCATGATACGGATGTGCGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152486
VALIDATED
SAMD11 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152486.2-2200s1c1
Sequence:CCGGCCGCTTTATTTCTTTCGGTTTCTCGAGAAACCGAAAGAAATAAAGCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152486.2-348s21c1
Sequence:CCGGTGGGACGTGAACATCTCTTTCCTCGAGGAAAGAGATGTTCACGTCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152486.2-2166s21c1
Sequence:CCGGGAGCCACCACTCAACACAATGCTCGAGCATTGTGTTGAGTGGTGGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152486.2-317s1c1
Sequence:CCGGCCGTATCATGAAGAGAAGAGTCTCGAGACTCTTCTCTTCATGATACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152486.2-1756s21c1
Sequence:CCGGGAGAGTACACTCGGGTCTTCACTCGAGTGAAGACCCGAGTGTACTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152486.2-394s21c1
Sequence:CCGGGCAACCTTCCCACCCTCATATCTCGAGATATGAGGGTGGGAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152486.2-307s21c1
Sequence:CCGGGTCCGCACATCCGTATCATGACTCGAGTCATGATACGGATGTGCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173736
SAMD11 MISSION shRNA Bacterial Glycerol Stock
sterile alpha motif domain containing 11
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-578s21c1
Sequence:CCGGACGGAAGCAAGGCCTAGTTCACTCGAGTGAACTAGGCCTTGCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-440s21c1
Sequence:CCGGTGAGGAAACTCAACGTCTCTACTCGAGTAGAGACGTTGAGTTTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-853s21c1
Sequence:CCGGCAGAGTTGCTTAGGCAGAAAGCTCGAGCTTTCTGCCTAAGCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173736.2-855s1c1
Sequence:CCGGGAGTTGCTTAGGCAGAAAGAACTCGAGTTCTTTCTGCCTAAGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173736.2-1602s21c1
Sequence:CCGGTTTCTGGCTGTGGCGAGTATTCTCGAGAATACTCGCCACAGCCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-495s21c1
Sequence:CCGGGTACGCCAGGAAGTAGCAATTCTCGAGAATTGCTACTTCCTGGCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173736
SAMD11 MISSION shRNA shRNA Plasmid DNA
sterile alpha motif domain containing 11
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-578s21c1
Sequence:CCGGACGGAAGCAAGGCCTAGTTCACTCGAGTGAACTAGGCCTTGCTTCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-440s21c1
Sequence:CCGGTGAGGAAACTCAACGTCTCTACTCGAGTAGAGACGTTGAGTTTCCTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-853s21c1
Sequence:CCGGCAGAGTTGCTTAGGCAGAAAGCTCGAGCTTTCTGCCTAAGCAACTCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000190531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173736.2-855s1c1
Sequence:CCGGGAGTTGCTTAGGCAGAAAGAACTCGAGTTCTTTCTGCCTAAGCAACTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173736.2-1602s21c1
Sequence:CCGGTTTCTGGCTGTGGCGAGTATTCTCGAGAATACTCGCCACAGCCAGAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-495s21c1
Sequence:CCGGGTACGCCAGGAAGTAGCAATTCTCGAGAATTGCTACTTCCTGGCGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173736
SAMD11 MISSION shRNA Lentiviral Transduction Particles
sterile alpha motif domain containing 11
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-578s21c1
Sequence:CCGGACGGAAGCAAGGCCTAGTTCACTCGAGTGAACTAGGCCTTGCTTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-440s21c1
Sequence:CCGGTGAGGAAACTCAACGTCTCTACTCGAGTAGAGACGTTGAGTTTCCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-853s21c1
Sequence:CCGGCAGAGTTGCTTAGGCAGAAAGCTCGAGCTTTCTGCCTAAGCAACTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173736.2-855s1c1
Sequence:CCGGGAGTTGCTTAGGCAGAAAGAACTCGAGTTCTTTCTGCCTAAGCAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173736.2-1602s21c1
Sequence:CCGGTTTCTGGCTGTGGCGAGTATTCTCGAGAATACTCGCCACAGCCAGAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173736.2-495s21c1
Sequence:CCGGGTACGCCAGGAAGTAGCAATTCTCGAGAATTGCTACTTCCTGGCGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)