EMAIL THIS PAGE TO A FRIEND

SAMSN1

SAM domain, SH3 domain and nuclear localization signals 1

61 Gene Product Result for
Synonyms: HACS1 NASH1 SASH2 SH3D6B SLy2
UniProtKB ID: Q9NSI8, B3KWJ3, Q8NFF7, Q9C041
Gene ID:
Human(64092) Summary: SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]
Mouse(67742) SAM domain, SH3 domain and nuclear localization signals, 1
Rat(170637) SAM domain, SH3 domain and nuclear localization signals, 1
chicken(418470) SAM domain, SH3 domain and nuclear localization signals 1
dog(608104) SAM domain, SH3 domain and nuclear localization signals 1
domestic cat(101091964) SAM domain, SH3 domain and nuclear localization signals 1
naked mole-rat(101712817) SAM domain, SH3 domain and nuclear localization signals 1
domestic guinea pig(100714203) SAM domain, SH3 domain and nuclear localization signals 1
cow(534171) SAM domain, SH3 domain and nuclear localization signals 1
sheep(101117716) SAM domain, SH3 domain and nuclear localization signals 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062621 MISSION® esiRNA esiRNA human SAMSN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022136 Rosetta Predictions human pricing
NM_130821 Rosetta Predictions rat pricing
NM_023380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120866 predicted 423
2 SASI_Hs01_00120867 predicted 843
3 SASI_Hs01_00120868 predicted 922
4 SASI_Hs01_00120869 predicted 1154
5 SASI_Hs01_00120870 predicted 643
6 SASI_Hs01_00120871 predicted 878
7 SASI_Hs01_00120872 predicted 865
8 SASI_Hs01_00120873 predicted 951
9 SASI_Hs01_00120874 predicted 288
10 SASI_Hs02_00355546 predicted 1047
11 SASI_Hs01_00120875 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043704 predicted 206
2 SASI_Rn01_00043705 predicted 778
3 SASI_Rn01_00043706 predicted 747
4 SASI_Rn02_00267514 predicted 252
5 SASI_Rn01_00043707 predicted 829
6 SASI_Rn01_00043708 predicted 365
7 SASI_Rn01_00043709 predicted 528
8 SASI_Rn01_00043711 predicted 560
9 SASI_Rn01_00043712 predicted 400
10 SASI_Rn02_00267515 predicted 332
11 SASI_Rn01_00043710 predicted 765
12 SASI_Rn01_00043713 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327083 predicted 704
2 SASI_Mm01_00071483 predicted 611
3 SASI_Mm01_00071484 predicted 861
4 SASI_Mm01_00071485 predicted 804
5 SASI_Mm01_00071488 predicted 846
6 SASI_Mm01_00071489 predicted 645
7 SASI_Mm01_00071490 predicted 756
8 SASI_Mm01_00071491 predicted 876
9 SASI_Mm02_00327084 predicted 1114
10 SASI_Mm01_00071492 predicted 1092
11 SASI_Mm01_00071486 predicted 911
12 SASI_Mm01_00071487 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022136
SAMSN1 MISSION shRNA Bacterial Glycerol Stock
SAM domain, SH3 domain and nuclear localization signals 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022136.3-1205s21c1
Sequence:CCGGACACGCATTCCCAACTATATACTCGAGTATATAGTTGGGAATGCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-1144s1c1
Sequence:CCGGGCAGGAATACACCTCAACACTCTCGAGAGTGTTGAGGTGTATTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-510s1c1
Sequence:CCGGCACATGAAGGAGATCCCACAACTCGAGTTGTGGGATCTCCTTCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-940s1c1
Sequence:CCGGGAAAGGAGACATCATAGACATCTCGAGATGTCTATGATGTCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-801s1c1
Sequence:CCGGGCTGTTCAGATGGTACAAGTACTCGAGTACTTGTACCATCTGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-1383s1c1
Sequence:CCGGCAAGGGACTCTGGTTGCTATACTCGAGTATAGCAACCAGAGTCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022136.3-583s21c1
Sequence:CCGGTGCCAGAGTGCATACGGATTTCTCGAGAAATCCGTATGCACTCTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022136.3-1658s21c1
Sequence:CCGGGAGTTAATATTGGACACATTTCTCGAGAAATGTGTCCAATATTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022136
SAMSN1 MISSION shRNA shRNA Plasmid DNA
SAM domain, SH3 domain and nuclear localization signals 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022136.3-1205s21c1
Sequence:CCGGACACGCATTCCCAACTATATACTCGAGTATATAGTTGGGAATGCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-1144s1c1
Sequence:CCGGGCAGGAATACACCTCAACACTCTCGAGAGTGTTGAGGTGTATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-510s1c1
Sequence:CCGGCACATGAAGGAGATCCCACAACTCGAGTTGTGGGATCTCCTTCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-940s1c1
Sequence:CCGGGAAAGGAGACATCATAGACATCTCGAGATGTCTATGATGTCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-801s1c1
Sequence:CCGGGCTGTTCAGATGGTACAAGTACTCGAGTACTTGTACCATCTGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-1383s1c1
Sequence:CCGGCAAGGGACTCTGGTTGCTATACTCGAGTATAGCAACCAGAGTCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022136.3-583s21c1
Sequence:CCGGTGCCAGAGTGCATACGGATTTCTCGAGAAATCCGTATGCACTCTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022136.3-1658s21c1
Sequence:CCGGGAGTTAATATTGGACACATTTCTCGAGAAATGTGTCCAATATTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022136
SAMSN1 MISSION shRNA Lentiviral Transduction Particles
SAM domain, SH3 domain and nuclear localization signals 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022136.3-1205s21c1
Sequence:CCGGACACGCATTCCCAACTATATACTCGAGTATATAGTTGGGAATGCGTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-1144s1c1
Sequence:CCGGGCAGGAATACACCTCAACACTCTCGAGAGTGTTGAGGTGTATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-510s1c1
Sequence:CCGGCACATGAAGGAGATCCCACAACTCGAGTTGTGGGATCTCCTTCATGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-940s1c1
Sequence:CCGGGAAAGGAGACATCATAGACATCTCGAGATGTCTATGATGTCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-801s1c1
Sequence:CCGGGCTGTTCAGATGGTACAAGTACTCGAGTACTTGTACCATCTGAACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022136.2-1383s1c1
Sequence:CCGGCAAGGGACTCTGGTTGCTATACTCGAGTATAGCAACCAGAGTCCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022136.3-583s21c1
Sequence:CCGGTGCCAGAGTGCATACGGATTTCTCGAGAAATCCGTATGCACTCTGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022136.3-1658s21c1
Sequence:CCGGGAGTTAATATTGGACACATTTCTCGAGAAATGTGTCCAATATTAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023380
SAMSN1 MISSION shRNA Bacterial Glycerol Stock
SAM domain, SH3 domain and nuclear localization signals 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023380.2-1493s1c1
Sequence:CCGGCATGGAGACCACGTACTAATACTCGAGTATTAGTACGTGGTCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-264s21c1
Sequence:CCGGAGTGGAGGAAGTCTAGGTAAACTCGAGTTTACCTAGACTTCCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023380.1-765s1c1
Sequence:CCGGCCAGACTATCCAGGAGTTCTTCTCGAGAAGAACTCCTGGATAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-1082s21c1
Sequence:CCGGGAGGGACTCTGGCTGTTATATCTCGAGATATAACAGCCAGAGTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023380.2-1494s21c1
Sequence:CCGGATGGAGACCACGTACTAATATCTCGAGATATTAGTACGTGGTCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-449s21c1
Sequence:CCGGCGACTCTATGGACAGTCTTTACTCGAGTAAAGACTGTCCATAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023380.1-774s1c1
Sequence:CCGGCCAGGAGTTCTTAGAGAGGATCTCGAGATCCTCTCTAAGAACTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-614s21c1
Sequence:CCGGCTATGACACCGACTCCCTTAACTCGAGTTAAGGGAGTCGGTGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023380
SAMSN1 MISSION shRNA shRNA Plasmid DNA
SAM domain, SH3 domain and nuclear localization signals 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023380.2-1493s1c1
Sequence:CCGGCATGGAGACCACGTACTAATACTCGAGTATTAGTACGTGGTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-264s21c1
Sequence:CCGGAGTGGAGGAAGTCTAGGTAAACTCGAGTTTACCTAGACTTCCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023380.1-765s1c1
Sequence:CCGGCCAGACTATCCAGGAGTTCTTCTCGAGAAGAACTCCTGGATAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-1082s21c1
Sequence:CCGGGAGGGACTCTGGCTGTTATATCTCGAGATATAACAGCCAGAGTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023380.2-1494s21c1
Sequence:CCGGATGGAGACCACGTACTAATATCTCGAGATATTAGTACGTGGTCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-449s21c1
Sequence:CCGGCGACTCTATGGACAGTCTTTACTCGAGTAAAGACTGTCCATAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023380.1-774s1c1
Sequence:CCGGCCAGGAGTTCTTAGAGAGGATCTCGAGATCCTCTCTAAGAACTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-614s21c1
Sequence:CCGGCTATGACACCGACTCCCTTAACTCGAGTTAAGGGAGTCGGTGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023380
SAMSN1 MISSION shRNA Lentiviral Transduction Particles
SAM domain, SH3 domain and nuclear localization signals 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023380.2-1493s1c1
Sequence:CCGGCATGGAGACCACGTACTAATACTCGAGTATTAGTACGTGGTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-264s21c1
Sequence:CCGGAGTGGAGGAAGTCTAGGTAAACTCGAGTTTACCTAGACTTCCTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023380.1-765s1c1
Sequence:CCGGCCAGACTATCCAGGAGTTCTTCTCGAGAAGAACTCCTGGATAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-1082s21c1
Sequence:CCGGGAGGGACTCTGGCTGTTATATCTCGAGATATAACAGCCAGAGTCCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023380.2-1494s21c1
Sequence:CCGGATGGAGACCACGTACTAATATCTCGAGATATTAGTACGTGGTCTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-449s21c1
Sequence:CCGGCGACTCTATGGACAGTCTTTACTCGAGTAAAGACTGTCCATAGAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023380.1-774s1c1
Sequence:CCGGCCAGGAGTTCTTAGAGAGGATCTCGAGATCCTCTCTAAGAACTCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023380.2-614s21c1
Sequence:CCGGCTATGACACCGACTCCCTTAACTCGAGTTAAGGGAGTCGGTGTCATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)