EMAIL THIS PAGE TO A FRIEND

SAP25

Sin3A-associated protein, 25kDa

32 Gene Product Result for
UniProtKB ID: Q8TEE9
Gene ID:
Mouse(751865) sin3 associated polypeptide
Rat(288559) Sin3A-associated protein 25
cow(100296776) Sin3A-associated protein, 25kDa
domestic guinea pig(100714026) Sin3A-associated protein, 25kDa
naked mole-rat(101716784) Sin3A-associated protein, 25kDa
domestic cat(101100686) Sin3A-associated protein, 25kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062610 Anti-SAP25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001076431 Rosetta Predictions rat pricing
XM_213736 Rosetta Predictions rat pricing
NM_001081962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353176 predicted 241
2 SASI_Rn02_00353177 predicted 246
3 SASI_Rn02_00353178 predicted 242
4 SASI_Rn02_00353179 predicted 244
5 SASI_Rn02_00353180 predicted 234
6 SASI_Rn02_00353181 predicted 246
7 SASI_Rn02_00353182 predicted 251
8 SASI_Rn02_00353183 predicted 247
9 SASI_Rn02_00353184 predicted 235
10 SASI_Rn02_00353185 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374875 predicted 238
2 SASI_Rn02_00374876 predicted 246
3 SASI_Rn02_00374877 predicted 239
4 SASI_Rn02_00374878 predicted 238
5 SASI_Rn02_00374879 predicted 238
6 SASI_Rn02_00374880 predicted 247
7 SASI_Rn02_00374881 predicted 247
8 SASI_Rn02_00374882 predicted 248
9 SASI_Rn02_00374883 predicted 239
10 SASI_Rn02_00374884 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299122 predicted 835
2 SASI_Mm02_00299123 predicted 495
3 SASI_Mm02_00299124 predicted 491
4 SASI_Mm02_00299125 predicted 459
5 SASI_Mm02_00299126 predicted 604
6 SASI_Mm02_00299127 predicted 676
7 SASI_Mm02_00299128 predicted 589
8 SASI_Mm02_00299129 predicted 487
9 SASI_Mm02_00299130 predicted 592
10 SASI_Mm02_00299131 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081962
SAP25 MISSION shRNA Bacterial Glycerol Stock
Sin3A-associated protein, 25kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-467s21c1
Sequence:CCGGGGGTATCTTTGTCTAACAGGACTCGAGTCCTGTTAGACAAAGATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-559s21c1
Sequence:CCGGGAAGAGCAGGTGGTGTCTAAGCTCGAGCTTAGACACCACCTGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-497s21c1
Sequence:CCGGATCCTTCCTGGCCGATGTATGCTCGAGCATACATCGGCCAGGAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-599s21c1
Sequence:CCGGGAAACTATGAAGATGTCTTTCCTCGAGGAAAGACATCTTCATAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-623s21c1
Sequence:CCGGTGGATCCTCTGCTACCATGTGCTCGAGCACATGGTAGCAGAGGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081962
SAP25 MISSION shRNA shRNA Plasmid DNA
Sin3A-associated protein, 25kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-467s21c1
Sequence:CCGGGGGTATCTTTGTCTAACAGGACTCGAGTCCTGTTAGACAAAGATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-559s21c1
Sequence:CCGGGAAGAGCAGGTGGTGTCTAAGCTCGAGCTTAGACACCACCTGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-497s21c1
Sequence:CCGGATCCTTCCTGGCCGATGTATGCTCGAGCATACATCGGCCAGGAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-599s21c1
Sequence:CCGGGAAACTATGAAGATGTCTTTCCTCGAGGAAAGACATCTTCATAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-623s21c1
Sequence:CCGGTGGATCCTCTGCTACCATGTGCTCGAGCACATGGTAGCAGAGGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081962
SAP25 MISSION shRNA Lentiviral Transduction Particles
Sin3A-associated protein, 25kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-467s21c1
Sequence:CCGGGGGTATCTTTGTCTAACAGGACTCGAGTCCTGTTAGACAAAGATACCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000265677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-559s21c1
Sequence:CCGGGAAGAGCAGGTGGTGTCTAAGCTCGAGCTTAGACACCACCTGCTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-497s21c1
Sequence:CCGGATCCTTCCTGGCCGATGTATGCTCGAGCATACATCGGCCAGGAAGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-599s21c1
Sequence:CCGGGAAACTATGAAGATGTCTTTCCTCGAGGAAAGACATCTTCATAGTTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081962.1-623s21c1
Sequence:CCGGTGGATCCTCTGCTACCATGTGCTCGAGCACATGGTAGCAGAGGATCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???