EMAIL THIS PAGE TO A FRIEND

SAP30

Sin3A-associated protein, 30kDa

55 Gene Product Result for
UniProtKB ID: O75446, D3DP38
Gene ID:
Human(8819) Summary: Histone acetylation plays a key role in the regulation of eukaryotic gene expression. Histone acetylation and deacetylation are catalyzed by multisubunit complexes. The protein encoded by this gene is a component of the histone deacetylase complex, which includes SIN3, SAP18, HDAC1, HDAC2, RbAp46, RbAp48, and other polypeptides. This complex is active in deacetylating core histone octamers, but inactive in deacetylating nucleosomal histones. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Jul 2008]
Mouse(60406) sin3 associated polypeptide
Rat(680122) Sin3A-associated protein
fruit fly(32664) SIN3-associated polypeptide 30
domestic cat(101088572) Sin3A-associated protein, 30kDa
dog(607359) Sin3A-associated protein, 30kDa
chicken(422562) Sin3A-associated protein, 30kDa
naked mole-rat(101711052) Sin3A-associated protein, 30kDa
domestic guinea pig(100727110) Sin3A-associated protein, 30kDa
cow(781150) Sin3A-associated protein, 30kDa
sheep(101113471) Sin3A-associated protein, 30kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004281 MISSION® esiRNA esiRNA targeting mouse Sap30 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003864 Rosetta Predictions human pricing
XM_001055813 Rosetta Predictions rat pricing
NM_021788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235276 predicted 726
2 SASI_Hs01_00235277 predicted 796
3 SASI_Hs01_00235278 predicted 735
4 SASI_Hs01_00235279 predicted 645
5 SASI_Hs01_00235280 predicted 742
6 SASI_Hs01_00235282 predicted 557
7 SASI_Hs01_00235283 predicted 562
8 SASI_Hs02_00336442 predicted 681
9 SASI_Hs01_00235284 predicted 822
10 SASI_Hs02_00336443 predicted 538
11 SASI_Hs01_00235281 predicted 832
12 SASI_Hs01_00235285 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281105 predicted 498
2 SASI_Rn02_00281106 predicted 556
3 SASI_Rn02_00281107 predicted 401
4 SASI_Rn02_00281108 predicted 451
5 SASI_Rn02_00281109 predicted 445
6 SASI_Rn02_00281110 predicted 586
7 SASI_Rn02_00281111 predicted 542
8 SASI_Rn02_00281112 predicted 562
9 SASI_Rn02_00281113 predicted 409
10 SASI_Rn02_00281114 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089256 predicted 835
2 SASI_Mm01_00089257 predicted 757
3 SASI_Mm01_00089258 predicted 710
4 SASI_Mm01_00089259 predicted 610
5 SASI_Mm01_00089260 predicted 727
6 SASI_Mm02_00326422 predicted 639
7 SASI_Mm01_00089261 predicted 719
8 SASI_Mm01_00089262 predicted 785
9 SASI_Mm01_00089263 predicted 738
10 SASI_Mm02_00326423 predicted 826
11 SASI_Mm01_00089264 predicted 804
12 SASI_Mm01_00089265 predicted 730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003864
VALIDATED
SAP30 MISSION shRNA Bacterial Glycerol Stock
Sin3A-associated protein, 30kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003864.3-677s21c1
Sequence:CCGGCCAGAGGTTGATTTATACCAACTCGAGTTGGTATAAATCAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-767s21c1
Sequence:CCGGGCACAACTTGTTGAGATAGTTCTCGAGAACTATCTCAACAAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-851s21c1
Sequence:CCGGGTGAAGAATGACAAGAACAAACTCGAGTTTGTTCTTGTCATTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_003864.1-766s1c1
Sequence:CCGGGCACAACTTGTTGAGATAGTTCTCGAGAACTATCTCAACAAGTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003864.1-877s1c1
Sequence:CCGGCTCAAGGTTGATAGTGGTGTTCTCGAGAACACCACTATCAACCTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_003864.1-850s1c1
Sequence:CCGGGTGAAGAATGACAAGAACAAACTCGAGTTTGTTCTTGTCATTCTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-878s21c1
Sequence:CCGGCTCAAGGTTGATAGTGGTGTTCTCGAGAACACCACTATCAACCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003864.3-908s21c1
Sequence:GTACCGGACGTGGAATTGAGACTAATAACTCGAGTTATTAGTCTCAATTCCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003864
VALIDATED
SAP30 MISSION shRNA shRNA Plasmid DNA
Sin3A-associated protein, 30kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003864.3-677s21c1
Sequence:CCGGCCAGAGGTTGATTTATACCAACTCGAGTTGGTATAAATCAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-767s21c1
Sequence:CCGGGCACAACTTGTTGAGATAGTTCTCGAGAACTATCTCAACAAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-851s21c1
Sequence:CCGGGTGAAGAATGACAAGAACAAACTCGAGTTTGTTCTTGTCATTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_003864.1-766s1c1
Sequence:CCGGGCACAACTTGTTGAGATAGTTCTCGAGAACTATCTCAACAAGTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003864.1-877s1c1
Sequence:CCGGCTCAAGGTTGATAGTGGTGTTCTCGAGAACACCACTATCAACCTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_003864.1-850s1c1
Sequence:CCGGGTGAAGAATGACAAGAACAAACTCGAGTTTGTTCTTGTCATTCTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-878s21c1
Sequence:CCGGCTCAAGGTTGATAGTGGTGTTCTCGAGAACACCACTATCAACCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003864.3-908s21c1
Sequence:GTACCGGACGTGGAATTGAGACTAATAACTCGAGTTATTAGTCTCAATTCCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003864
VALIDATED
SAP30 MISSION shRNA Lentiviral Transduction Particles
Sin3A-associated protein, 30kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003864.3-677s21c1
Sequence:CCGGCCAGAGGTTGATTTATACCAACTCGAGTTGGTATAAATCAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-767s21c1
Sequence:CCGGGCACAACTTGTTGAGATAGTTCTCGAGAACTATCTCAACAAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-851s21c1
Sequence:CCGGGTGAAGAATGACAAGAACAAACTCGAGTTTGTTCTTGTCATTCTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_003864.1-766s1c1
Sequence:CCGGGCACAACTTGTTGAGATAGTTCTCGAGAACTATCTCAACAAGTTGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003864.1-877s1c1
Sequence:CCGGCTCAAGGTTGATAGTGGTGTTCTCGAGAACACCACTATCAACCTTGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_003864.1-850s1c1
Sequence:CCGGGTGAAGAATGACAAGAACAAACTCGAGTTTGTTCTTGTCATTCTTCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003864.3-878s21c1
Sequence:CCGGCTCAAGGTTGATAGTGGTGTTCTCGAGAACACCACTATCAACCTTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003864.3-908s21c1
Sequence:GTACCGGACGTGGAATTGAGACTAATAACTCGAGTTATTAGTCTCAATTCCACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021788
VALIDATED
SAP30 MISSION shRNA Bacterial Glycerol Stock
Sin3A-associated protein, 30kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-976s21c1
Sequence:CCGGGCTGTTCACACTAGCCCATAGCTCGAGCTATGGGCTAGTGTGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-844s21c1
Sequence:CCGGAGATAGTTGGTTGCCACTTTACTCGAGTAAAGTGGCAACCAACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-807s21c1
Sequence:CCGGCCAACCAGACCAGGTCTAAATCTCGAGATTTAGACCTGGTCTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-734s21c1
Sequence:CCGGCGACACTCCAGAGGTTGATTTCTCGAGAAATCAACCTCTGGAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-614s21c1
Sequence:CCGGTAAGAGTGCAAGGCATCTTTACTCGAGTAAAGATGCCTTGCACTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021788.1-816s1c1
Sequence:CCGGCCAGGTCTAAATAAAGCACAACTCGAGTTGTGCTTTATTTAGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-991s1c1
Sequence:CCGGCCATAGATGTCTGCCTGGAAACTCGAGTTTCCAGGCAGACATCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-581s1c1
Sequence:CCGGCATCTCTCAGAAGAAGGTGAACTCGAGTTCACCTTCTTCTGAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-843s1c1
Sequence:CCGGGAGATAGTTGGTTGCCACTTTCTCGAGAAAGTGGCAACCAACTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021788.1-741s1c1
Sequence:CCGGCCAGAGGTTGATTTGTACCAACTCGAGTTGGTACAAATCAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021788
VALIDATED
SAP30 MISSION shRNA shRNA Plasmid DNA
Sin3A-associated protein, 30kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-976s21c1
Sequence:CCGGGCTGTTCACACTAGCCCATAGCTCGAGCTATGGGCTAGTGTGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-844s21c1
Sequence:CCGGAGATAGTTGGTTGCCACTTTACTCGAGTAAAGTGGCAACCAACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-807s21c1
Sequence:CCGGCCAACCAGACCAGGTCTAAATCTCGAGATTTAGACCTGGTCTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-734s21c1
Sequence:CCGGCGACACTCCAGAGGTTGATTTCTCGAGAAATCAACCTCTGGAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-614s21c1
Sequence:CCGGTAAGAGTGCAAGGCATCTTTACTCGAGTAAAGATGCCTTGCACTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021788.1-816s1c1
Sequence:CCGGCCAGGTCTAAATAAAGCACAACTCGAGTTGTGCTTTATTTAGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-991s1c1
Sequence:CCGGCCATAGATGTCTGCCTGGAAACTCGAGTTTCCAGGCAGACATCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-581s1c1
Sequence:CCGGCATCTCTCAGAAGAAGGTGAACTCGAGTTCACCTTCTTCTGAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-843s1c1
Sequence:CCGGGAGATAGTTGGTTGCCACTTTCTCGAGAAAGTGGCAACCAACTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021788.1-741s1c1
Sequence:CCGGCCAGAGGTTGATTTGTACCAACTCGAGTTGGTACAAATCAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021788
VALIDATED
SAP30 MISSION shRNA Lentiviral Transduction Particles
Sin3A-associated protein, 30kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-976s21c1
Sequence:CCGGGCTGTTCACACTAGCCCATAGCTCGAGCTATGGGCTAGTGTGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-844s21c1
Sequence:CCGGAGATAGTTGGTTGCCACTTTACTCGAGTAAAGTGGCAACCAACTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-807s21c1
Sequence:CCGGCCAACCAGACCAGGTCTAAATCTCGAGATTTAGACCTGGTCTGGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-734s21c1
Sequence:CCGGCGACACTCCAGAGGTTGATTTCTCGAGAAATCAACCTCTGGAGTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021788.1-614s21c1
Sequence:CCGGTAAGAGTGCAAGGCATCTTTACTCGAGTAAAGATGCCTTGCACTCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021788.1-816s1c1
Sequence:CCGGCCAGGTCTAAATAAAGCACAACTCGAGTTGTGCTTTATTTAGACCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-991s1c1
Sequence:CCGGCCATAGATGTCTGCCTGGAAACTCGAGTTTCCAGGCAGACATCTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-581s1c1
Sequence:CCGGCATCTCTCAGAAGAAGGTGAACTCGAGTTCACCTTCTTCTGAGAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021788.1-843s1c1
Sequence:CCGGGAGATAGTTGGTTGCCACTTTCTCGAGAAAGTGGCAACCAACTATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021788.1-741s1c1
Sequence:CCGGCCAGAGGTTGATTTGTACCAACTCGAGTTGGTACAAATCAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)