EMAIL THIS PAGE TO A FRIEND

SAP30BP

SAP30 binding protein

96 Gene Product Result for
Synonyms: HCNGP HTRG HTRP
UniProtKB ID: Q9UHR5, B3KML7, Q8N1R5, Q8TDR8, Q96D27
Gene ID:
Mouse(57230) SAP30 binding protein
Rat(360662) SAP30 binding protein
cow(513544) SAP30 binding protein
sheep(101109195) SAP30 binding protein
domestic guinea pig(100718436) SAP30 binding protein
naked mole-rat(101725611) SAP30 binding protein
Zebrafish(321738) SAP30 binding protein
domestic cat(101101428) SAP30 binding protein
dog(608519) SAP30 binding protein
chicken(417375) SAP30 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052943 Anti-SAP30BP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013260 Rosetta Predictions human pricing
NM_001108305 Rosetta Predictions rat pricing
NM_020483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223393 predicted 1246
2 SASI_Hs01_00223394 predicted 461
3 SASI_Hs01_00223395 predicted 375
4 SASI_Hs01_00223397 predicted 457
5 SASI_Hs01_00223398 predicted 519
6 SASI_Hs01_00223399 predicted 441
7 SASI_Hs01_00223400 predicted 1308
8 SASI_Hs02_00344480 predicted 313
9 SASI_Hs01_00223401 predicted 1208
10 SASI_Hs01_00223402 predicted 1109
11 SASI_Hs01_00223396 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237349 predicted 283
2 SASI_Rn02_00237350 predicted 1236
3 SASI_Rn02_00237351 predicted 402
4 SASI_Rn02_00237352 predicted 1444
5 SASI_Rn02_00237353 predicted 568
6 SASI_Rn02_00237354 predicted 1253
7 SASI_Rn02_00237355 predicted 1414
8 SASI_Rn02_00237356 predicted 328
9 SASI_Rn02_00237357 predicted 914
10 SASI_Rn02_00237358 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039404 predicted 382
2 SASI_Mm01_00039405 predicted 259
3 SASI_Mm01_00039406 predicted 304
4 SASI_Mm01_00039407 predicted 345
5 SASI_Mm02_00325536 predicted 1108
6 SASI_Mm01_00039408 predicted 545
7 SASI_Mm01_00039409 predicted 395
8 SASI_Mm01_00039410 predicted 605
9 SASI_Mm01_00039411 predicted 617
10 SASI_Mm01_00039412 predicted 628
11 SASI_Mm01_00039413 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020483
VALIDATED
SAP30BP MISSION shRNA Bacterial Glycerol Stock
SAP30 binding protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-61s1c1
Sequence:CCGGCGGAATATTCAGACCCTGAATCTCGAGATTCAGGGTCTGAATATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-626s1c1
Sequence:CCGGCCAGAAGATTGAAATGGACAACTCGAGTTGTCCATTTCAATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-123s1c1
Sequence:CCGGGAGGAGAAAGGTGGTTTGGTACTCGAGTACCAAACCACCTTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-550s1c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020483.3-384s21c1
Sequence:CCGGCCGCCTGGCAGATGTTCAAATCTCGAGATTTGAACATCTGCCAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-48s21c1
Sequence:CCGGCTTGCAATTTATGCGGAATATCTCGAGATATTCCGCATAAATTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020483.2-1452s1c1
Sequence:CCGGCCTCAACAATTCACAACAATTCTCGAGAATTGTTGTGAATTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020483.3-1098s21c1
Sequence:CCGGATTCCAGCCGGAAGGACATTACTCGAGTAATGTCCTTCCGGCTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020483.3-1352s21c1
Sequence:CCGGCGTGCTCATTCCCAGTGTATGCTCGAGCATACACTGGGAATGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-589s21c1
Sequence:CCGGGGTCTGAAGACTCCTACTATGCTCGAGCATAGTAGGAGTCTTCAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-123s21c1
Sequence:CCGGGAGGAGAAAGGTGGTTTGGTACTCGAGTACCAAACCACCTTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-550s21c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020483
VALIDATED
SAP30BP MISSION shRNA shRNA Plasmid DNA
SAP30 binding protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-61s1c1
Sequence:CCGGCGGAATATTCAGACCCTGAATCTCGAGATTCAGGGTCTGAATATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-626s1c1
Sequence:CCGGCCAGAAGATTGAAATGGACAACTCGAGTTGTCCATTTCAATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-123s1c1
Sequence:CCGGGAGGAGAAAGGTGGTTTGGTACTCGAGTACCAAACCACCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-550s1c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020483.3-384s21c1
Sequence:CCGGCCGCCTGGCAGATGTTCAAATCTCGAGATTTGAACATCTGCCAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-48s21c1
Sequence:CCGGCTTGCAATTTATGCGGAATATCTCGAGATATTCCGCATAAATTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020483.2-1452s1c1
Sequence:CCGGCCTCAACAATTCACAACAATTCTCGAGAATTGTTGTGAATTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020483.3-1098s21c1
Sequence:CCGGATTCCAGCCGGAAGGACATTACTCGAGTAATGTCCTTCCGGCTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020483.3-1352s21c1
Sequence:CCGGCGTGCTCATTCCCAGTGTATGCTCGAGCATACACTGGGAATGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-589s21c1
Sequence:CCGGGGTCTGAAGACTCCTACTATGCTCGAGCATAGTAGGAGTCTTCAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-123s21c1
Sequence:CCGGGAGGAGAAAGGTGGTTTGGTACTCGAGTACCAAACCACCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-550s21c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020483
VALIDATED
SAP30BP MISSION shRNA Lentiviral Transduction Particles
SAP30 binding protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-61s1c1
Sequence:CCGGCGGAATATTCAGACCCTGAATCTCGAGATTCAGGGTCTGAATATTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-626s1c1
Sequence:CCGGCCAGAAGATTGAAATGGACAACTCGAGTTGTCCATTTCAATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-123s1c1
Sequence:CCGGGAGGAGAAAGGTGGTTTGGTACTCGAGTACCAAACCACCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020483.2-550s1c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020483.3-384s21c1
Sequence:CCGGCCGCCTGGCAGATGTTCAAATCTCGAGATTTGAACATCTGCCAGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-48s21c1
Sequence:CCGGCTTGCAATTTATGCGGAATATCTCGAGATATTCCGCATAAATTGCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020483.2-1452s1c1
Sequence:CCGGCCTCAACAATTCACAACAATTCTCGAGAATTGTTGTGAATTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020483.3-1098s21c1
Sequence:CCGGATTCCAGCCGGAAGGACATTACTCGAGTAATGTCCTTCCGGCTGGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020483.3-1352s21c1
Sequence:CCGGCGTGCTCATTCCCAGTGTATGCTCGAGCATACACTGGGAATGAGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-589s21c1
Sequence:CCGGGGTCTGAAGACTCCTACTATGCTCGAGCATAGTAGGAGTCTTCAGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-123s21c1
Sequence:CCGGGAGGAGAAAGGTGGTTTGGTACTCGAGTACCAAACCACCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020483.3-550s21c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013260
VALIDATED
SAP30BP MISSION shRNA Bacterial Glycerol Stock
SAP30 binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-263s21c1
Sequence:CCGGGACAGTCGGAAGATGACGATTCTCGAGAATCGTCATCTTCCGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-459s21c1
Sequence:CCGGCCAGAAGCTTTATGAACGAAACTCGAGTTTCGTTCATAAAGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-550s1c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-363s1c1
Sequence:CCGGGAAATCAAGATCCCGCCAGAACTCGAGTTCTGGCGGGATCTTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-422s1c1
Sequence:CCGGCCAGAAGCTTTATGAACGAAACTCGAGTTTCGTTCATAAAGCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013260.4-207s1c1
Sequence:CCGGGAAGAAGATGAGAACAGTAGACTCGAGTCTACTGTTCTCATCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-597s1c1
Sequence:CCGGGACTCCTACTATGAGGCATTACTCGAGTAATGCCTCATAGTAGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-226s1c1
Sequence:CCGGGACAGTCGGAAGATGACGATTCTCGAGAATCGTCATCTTCCGACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-400s21c1
Sequence:CCGGGAAATCAAGATCCCGCCAGAACTCGAGTTCTGGCGGGATCTTGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-587s21c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013260
VALIDATED
SAP30BP MISSION shRNA shRNA Plasmid DNA
SAP30 binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-263s21c1
Sequence:CCGGGACAGTCGGAAGATGACGATTCTCGAGAATCGTCATCTTCCGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-459s21c1
Sequence:CCGGCCAGAAGCTTTATGAACGAAACTCGAGTTTCGTTCATAAAGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-550s1c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-363s1c1
Sequence:CCGGGAAATCAAGATCCCGCCAGAACTCGAGTTCTGGCGGGATCTTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-422s1c1
Sequence:CCGGCCAGAAGCTTTATGAACGAAACTCGAGTTTCGTTCATAAAGCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013260.4-207s1c1
Sequence:CCGGGAAGAAGATGAGAACAGTAGACTCGAGTCTACTGTTCTCATCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-597s1c1
Sequence:CCGGGACTCCTACTATGAGGCATTACTCGAGTAATGCCTCATAGTAGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-226s1c1
Sequence:CCGGGACAGTCGGAAGATGACGATTCTCGAGAATCGTCATCTTCCGACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-400s21c1
Sequence:CCGGGAAATCAAGATCCCGCCAGAACTCGAGTTCTGGCGGGATCTTGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-587s21c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013260
VALIDATED
SAP30BP MISSION shRNA Lentiviral Transduction Particles
SAP30 binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-263s21c1
Sequence:CCGGGACAGTCGGAAGATGACGATTCTCGAGAATCGTCATCTTCCGACTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-459s21c1
Sequence:CCGGCCAGAAGCTTTATGAACGAAACTCGAGTTTCGTTCATAAAGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-550s1c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-363s1c1
Sequence:CCGGGAAATCAAGATCCCGCCAGAACTCGAGTTCTGGCGGGATCTTGATTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-422s1c1
Sequence:CCGGCCAGAAGCTTTATGAACGAAACTCGAGTTTCGTTCATAAAGCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013260.4-207s1c1
Sequence:CCGGGAAGAAGATGAGAACAGTAGACTCGAGTCTACTGTTCTCATCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-597s1c1
Sequence:CCGGGACTCCTACTATGAGGCATTACTCGAGTAATGCCTCATAGTAGGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013260.4-226s1c1
Sequence:CCGGGACAGTCGGAAGATGACGATTCTCGAGAATCGTCATCTTCCGACTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-400s21c1
Sequence:CCGGGAAATCAAGATCCCGCCAGAACTCGAGTTCTGGCGGGATCTTGATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013260.6-587s21c1
Sequence:CCGGGCACCAACTACCCAAAGGATACTCGAGTATCCTTTGGGTAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)