EMAIL THIS PAGE TO A FRIEND

SART1

squamous cell carcinoma antigen recognized by T cells

68 Gene Product Result for
Synonyms: Ara1 HOMS1 SART1259 SNRNP110 Snu66
UniProtKB ID: O43290, A6NDN1, Q53GB5
Gene ID:
Human(9092) Summary: This gene encodes two proteins, the SART1(800) protein expressed in the nucleus of the majority of proliferating cells, and the SART1(259) protein expressed in the cytosol of epithelial cancers. The SART1(259) protein is translated by the mechanism of -1 frameshifting during posttranscriptional regulation; its full-length sequence is not published yet. The two encoded proteins are thought to be involved in the regulation of proliferation. Both proteins have tumor-rejection antigens. The SART1(259) protein possesses tumor epitopes capable of inducing HLA-A2402-restricted cytotoxic T lymphocytes in cancer patients. This SART1(259) antigen may be useful in specific immunotherapy for cancer patients and may serve as a paradigmatic tool for the diagnosis and treatment of patients with atopy. The SART1(259) protein is found to be essential for the recruitment of the tri-snRNP to the pre-spliceosome in the spliceosome assembly pathway. [provided by RefSeq, Jul 2008]
Mouse(20227) squamous cell carcinoma antigen recognized by T cells 1
Rat(29678) squamous cell carcinoma antigen recognized by T cells
naked mole-rat(101706499) squamous cell carcinoma antigen recognized by T cells
domestic guinea pig(100725917) squamous cell carcinoma antigen recognized by T cells
cow(615704) squamous cell carcinoma antigen recognized by T cells
sheep(101103685) squamous cell carcinoma antigen recognized by T cells
Zebrafish(436946) squamous cell carcinoma antigen recognised by T cells
domestic cat(101080575) squamous cell carcinoma antigen recognized by T cells
dog(483721) squamous cell carcinoma antigen recognized by T cells
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005146 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005146 Rosetta Predictions human pricing
NM_031596 Rosetta Predictions rat pricing
NM_016882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015658 predicted 1096
2 SASI_Hs01_00015659 predicted 902
3 SASI_Hs01_00015660 predicted 1078
4 SASI_Hs01_00015661 predicted 1347
5 SASI_Hs02_00339081 predicted 1076
6 SASI_Hs01_00015662 predicted 2198
7 SASI_Hs01_00015663 predicted 870
8 SASI_Hs01_00015664 predicted 1123
9 SASI_Hs01_00015665 predicted 2325
10 SASI_Hs01_00015666 predicted 2149
11 SASI_Hs01_00015657 predicted 2603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071638 predicted 1089
2 SASI_Rn01_00071639 predicted 1050
3 SASI_Rn01_00071640 predicted 837
4 SASI_Rn01_00071641 predicted 1018
5 SASI_Rn01_00071642 predicted 2052
6 SASI_Rn01_00071643 predicted 463
7 SASI_Rn01_00071644 predicted 1050
8 SASI_Rn01_00071645 predicted 737
9 SASI_Rn01_00071646 predicted 1919
10 SASI_Rn01_00071647 predicted 1878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323695 predicted 1064
2 SASI_Mm02_00323696 predicted 427
3 SASI_Mm02_00323697 predicted 1040
4 SASI_Mm02_00323698 predicted 477
5 SASI_Mm02_00323699 predicted 2194
6 SASI_Mm02_00323700 predicted 2096
7 SASI_Mm02_00323701 predicted 1106
8 SASI_Mm01_00047790 predicted 759
9 SASI_Mm02_00323702 predicted 439
10 SASI_Mm02_00323703 predicted 2570
11 SASI_Mm01_00047784 predicted 2208
12 SASI_Mm01_00047785 predicted 1008
13 SASI_Mm01_00047786 predicted 1752
14 SASI_Mm01_00047787 predicted 2207
15 SASI_Mm01_00047788 predicted 1832
16 SASI_Mm01_00047789 predicted 1484
17 SASI_Mm01_00047791 predicted 2048
18 SASI_Mm01_00047792 predicted 1900
19 SASI_Mm01_00047793 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016882
VALIDATED
SART1 MISSION shRNA Bacterial Glycerol Stock
squamous cell carcinoma antigen recognized by T cells
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-1067s1c1
Sequence:CCGGCGTTCTATCCTGGCCAAATATCTCGAGATATTTGGCCAGGATAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016882.2-441s1c1
Sequence:CCGGAGACCAATAAACTCCGAGCAACTCGAGTTGCTCGGAGTTTATTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2107s21c1
Sequence:CCGGAGTGTACTGCATCGAGGATAACTCGAGTTATCCTCGATGCAGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016882.2-2198s1c1
Sequence:CCGGGATGGCTACAAGCCTGATGTTCTCGAGAACATCAGGCTTGTAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-1743s1c1
Sequence:CCGGCCATCGTGTTCAATGCCACTTCTCGAGAAGTGGCATTGAACACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-2209s1c1
Sequence:CCGGGCCTGATGTTAAGATTGAATACTCGAGTATTCAATCTTAACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2209s21c1
Sequence:CCGGGCCTGATGTTAAGATTGAATACTCGAGTATTCAATCTTAACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-1743s21c1
Sequence:CCGGCCATCGTGTTCAATGCCACTTCTCGAGAAGTGGCATTGAACACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016882.3-2904s21c1
Sequence:CCGGCCTGTCACACTGCGGTCAAATCTCGAGATTTGACCGCAGTGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2425s21c1
Sequence:CCGGGGCCCAGAAGACACCGTATATCTCGAGATATACGGTGTCTTCTGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016882
VALIDATED
SART1 MISSION shRNA shRNA Plasmid DNA
squamous cell carcinoma antigen recognized by T cells
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-1067s1c1
Sequence:CCGGCGTTCTATCCTGGCCAAATATCTCGAGATATTTGGCCAGGATAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016882.2-441s1c1
Sequence:CCGGAGACCAATAAACTCCGAGCAACTCGAGTTGCTCGGAGTTTATTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2107s21c1
Sequence:CCGGAGTGTACTGCATCGAGGATAACTCGAGTTATCCTCGATGCAGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016882.2-2198s1c1
Sequence:CCGGGATGGCTACAAGCCTGATGTTCTCGAGAACATCAGGCTTGTAGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-1743s1c1
Sequence:CCGGCCATCGTGTTCAATGCCACTTCTCGAGAAGTGGCATTGAACACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-2209s1c1
Sequence:CCGGGCCTGATGTTAAGATTGAATACTCGAGTATTCAATCTTAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2209s21c1
Sequence:CCGGGCCTGATGTTAAGATTGAATACTCGAGTATTCAATCTTAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-1743s21c1
Sequence:CCGGCCATCGTGTTCAATGCCACTTCTCGAGAAGTGGCATTGAACACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016882.3-2904s21c1
Sequence:CCGGCCTGTCACACTGCGGTCAAATCTCGAGATTTGACCGCAGTGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2425s21c1
Sequence:CCGGGGCCCAGAAGACACCGTATATCTCGAGATATACGGTGTCTTCTGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016882
VALIDATED
SART1 MISSION shRNA Lentiviral Transduction Particles
squamous cell carcinoma antigen recognized by T cells
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-1067s1c1
Sequence:CCGGCGTTCTATCCTGGCCAAATATCTCGAGATATTTGGCCAGGATAGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016882.2-441s1c1
Sequence:CCGGAGACCAATAAACTCCGAGCAACTCGAGTTGCTCGGAGTTTATTGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2107s21c1
Sequence:CCGGAGTGTACTGCATCGAGGATAACTCGAGTTATCCTCGATGCAGTACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016882.2-2198s1c1
Sequence:CCGGGATGGCTACAAGCCTGATGTTCTCGAGAACATCAGGCTTGTAGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-1743s1c1
Sequence:CCGGCCATCGTGTTCAATGCCACTTCTCGAGAAGTGGCATTGAACACGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016882.2-2209s1c1
Sequence:CCGGGCCTGATGTTAAGATTGAATACTCGAGTATTCAATCTTAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2209s21c1
Sequence:CCGGGCCTGATGTTAAGATTGAATACTCGAGTATTCAATCTTAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-1743s21c1
Sequence:CCGGCCATCGTGTTCAATGCCACTTCTCGAGAAGTGGCATTGAACACGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016882.3-2904s21c1
Sequence:CCGGCCTGTCACACTGCGGTCAAATCTCGAGATTTGACCGCAGTGTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016882.3-2425s21c1
Sequence:CCGGGGCCCAGAAGACACCGTATATCTCGAGATATACGGTGTCTTCTGGGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005146
VALIDATED
SART1 MISSION shRNA Bacterial Glycerol Stock
squamous cell carcinoma antigen recognized by T cells
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005146.x-408s1c1
Sequence:CCGGGACTAACAAACTCCGGGCAAACTCGAGTTTGCCCGGAGTTTGTTAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005146.x-2053s1c1
Sequence:CCGGGCCGTGTACTGCATCGAGGATCTCGAGATCCTCGATGCAGTACACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005146.x-1033s1c1
Sequence:CCGGCGCTCTATCCTGTCCAAGTATCTCGAGATACTTGGACAGGATAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-2105s21c1
Sequence:CCGGCGTGTACTGCATCGAGGATAACTCGAGTTATCCTCGATGCAGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005146.x-2468s1c1
Sequence:CCGGTGCCTCAACCTTCATATTAAACTCGAGTTTAATATGAAGGTTGAGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-487s21c1
Sequence:CCGGTGAAACCCTTGGAGGTTAATGCTCGAGCATTAACCTCCAAGGGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-2518s21c1
Sequence:CCGGTGCCTCAACCTTCATATTAAACTCGAGTTTAATATGAAGGTTGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005146.4-2207s21c1
Sequence:CCGGACCCGACGTTAAGATCGAATACTCGAGTATTCGATCTTAACGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-1010s21c1
Sequence:CCGGGCGGAAGAAGAAGCCTGACTACTCGAGTAGTCAGGCTTCTTCTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005146
VALIDATED
SART1 MISSION shRNA shRNA Plasmid DNA
squamous cell carcinoma antigen recognized by T cells
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005146.x-408s1c1
Sequence:CCGGGACTAACAAACTCCGGGCAAACTCGAGTTTGCCCGGAGTTTGTTAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005146.x-2053s1c1
Sequence:CCGGGCCGTGTACTGCATCGAGGATCTCGAGATCCTCGATGCAGTACACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005146.x-1033s1c1
Sequence:CCGGCGCTCTATCCTGTCCAAGTATCTCGAGATACTTGGACAGGATAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-2105s21c1
Sequence:CCGGCGTGTACTGCATCGAGGATAACTCGAGTTATCCTCGATGCAGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005146.x-2468s1c1
Sequence:CCGGTGCCTCAACCTTCATATTAAACTCGAGTTTAATATGAAGGTTGAGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-487s21c1
Sequence:CCGGTGAAACCCTTGGAGGTTAATGCTCGAGCATTAACCTCCAAGGGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-2518s21c1
Sequence:CCGGTGCCTCAACCTTCATATTAAACTCGAGTTTAATATGAAGGTTGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005146.4-2207s21c1
Sequence:CCGGACCCGACGTTAAGATCGAATACTCGAGTATTCGATCTTAACGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-1010s21c1
Sequence:CCGGGCGGAAGAAGAAGCCTGACTACTCGAGTAGTCAGGCTTCTTCTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005146
VALIDATED
SART1 MISSION shRNA Lentiviral Transduction Particles
squamous cell carcinoma antigen recognized by T cells
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005146.x-408s1c1
Sequence:CCGGGACTAACAAACTCCGGGCAAACTCGAGTTTGCCCGGAGTTTGTTAGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005146.x-2053s1c1
Sequence:CCGGGCCGTGTACTGCATCGAGGATCTCGAGATCCTCGATGCAGTACACGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005146.x-1033s1c1
Sequence:CCGGCGCTCTATCCTGTCCAAGTATCTCGAGATACTTGGACAGGATAGAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-2105s21c1
Sequence:CCGGCGTGTACTGCATCGAGGATAACTCGAGTTATCCTCGATGCAGTACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005146.x-2468s1c1
Sequence:CCGGTGCCTCAACCTTCATATTAAACTCGAGTTTAATATGAAGGTTGAGGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-487s21c1
Sequence:CCGGTGAAACCCTTGGAGGTTAATGCTCGAGCATTAACCTCCAAGGGTTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-2518s21c1
Sequence:CCGGTGCCTCAACCTTCATATTAAACTCGAGTTTAATATGAAGGTTGAGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005146.4-2207s21c1
Sequence:CCGGACCCGACGTTAAGATCGAATACTCGAGTATTCGATCTTAACGTCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005146.4-1010s21c1
Sequence:CCGGGCGGAAGAAGAAGCCTGACTACTCGAGTAGTCAGGCTTCTTCTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)