EMAIL THIS PAGE TO A FRIEND

SART3

squamous cell carcinoma antigen recognized by T cells 3

65 Gene Product Result for
Synonyms: DSAP1 P100 RP11-13G14 TIP110 p110 p110(nrb)
UniProtKB ID: Q15020, A8K2E4, Q2M2H0, Q58F06, Q8IUS1, Q96J95
Gene ID:
Human(9733) Summary: The protein encoded by this gene is an RNA-binding nuclear protein that is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is found to be an important cellular factor for HIV-1 gene expression and viral replication. It also associates transiently with U6 and U4/U6 snRNPs during the recycling phase of the spliceosome cycle. This encoded protein is thought to be involved in the regulation of mRNA splicing. [provided by RefSeq, Jul 2008]
Mouse(53890) squamous cell carcinoma antigen recognized by T cells 3
Rat(304582) squamous cell carcinoma antigen recognized by T-cells 3
Zebrafish(558581) squamous cell carcinoma antigen recognised by T cells 3
dog(486319) squamous cell carcinoma antigen recognized by T cells 3
Horse(100066913) squamous cell carcinoma antigen recognized by T cells 3
domestic cat(101088437) squamous cell carcinoma antigen recognized by T cells 3
chicken(416890) squamous cell carcinoma antigen recognized by T cells 3
cow(505922) squamous cell carcinoma antigen recognized by T cells 3
sheep(101103350) squamous cell carcinoma antigen recognized by T cells 3
domestic guinea pig(100726789) squamous cell carcinoma antigen recognized by T cells 3
naked mole-rat(101712823) squamous cell carcinoma antigen recognized by T cells 3
Domestic Rabbit(100354995) squamous cell carcinoma antigen recognized by T cells 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014706 Rosetta Predictions human pricing
NM_001107156 Rosetta Predictions rat pricing
NM_016926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115659 predicted 1265
2 SASI_Hs01_00115660 predicted 1043
3 SASI_Hs01_00115661 predicted 1302
4 SASI_Hs02_00346120 predicted 317
5 SASI_Hs02_00346121 predicted 2044
6 SASI_Hs01_00115662 predicted 781
7 SASI_Hs02_00346122 predicted 1002
8 SASI_Hs01_00115664 predicted 2457
9 SASI_Hs01_00115665 predicted 1750
10 SASI_Hs01_00115666 predicted 1281
11 SASI_Hs01_00115663 predicted 832
12 SASI_Hs01_00115667 predicted 360
13 SASI_Hs01_00115668 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226055 predicted 542
2 SASI_Rn02_00226056 predicted 553
3 SASI_Rn02_00226057 predicted 508
4 SASI_Rn02_00226058 predicted 1083
5 SASI_Rn02_00226059 predicted 2207
6 SASI_Rn02_00226060 predicted 1038
7 SASI_Rn02_00226061 predicted 2600
8 SASI_Rn02_00226062 predicted 578
9 SASI_Rn02_00226063 predicted 1415
10 SASI_Rn02_00226064 predicted 2445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080019 predicted 547
2 SASI_Mm01_00080020 predicted 960
3 SASI_Mm01_00080021 predicted 855
4 SASI_Mm01_00080022 predicted 1068
5 SASI_Mm02_00323789 predicted 1693
6 SASI_Mm01_00080023 predicted 1420
7 SASI_Mm01_00080024 predicted 1748
8 SASI_Mm01_00080026 predicted 1673
9 SASI_Mm01_00080027 predicted 562
10 SASI_Mm01_00080028 predicted 585
11 SASI_Mm01_00080025 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014706
SART3 MISSION shRNA Bacterial Glycerol Stock
squamous cell carcinoma antigen recognized by T cells 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-929s21c1
Sequence:CCGGCGAGAGTTTGAAAGTGCGATTCTCGAGAATCGCACTTTCAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-2257s1c1
Sequence:CCGGCGTGGAGTTTAAAGAAGAGAACTCGAGTTCTCTTCTTTAAACTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-2593s1c1
Sequence:CCGGCGGCATGACTATCAAAGAGAACTCGAGTTCTCTTTGATAGTCATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-986s1c1
Sequence:CCGGGCTCGCATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1108s21c1
Sequence:CCGGGCTGGAGAAATATAAACCCTACTCGAGTAGGGTTTATATTTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1622s21c1
Sequence:CCGGCGTTTCAATGAGAGTGGTGATCTCGAGATCACCACTCTCATTGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014706.2-3181s1c1
Sequence:CCGGCGAAACGAGAACACACTGTTTCTCGAGAAACAGTGTGTTCTCGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1214s21c1
Sequence:CCGGGCTCGCATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-701s1c1
Sequence:CCGGCGAGAGTTTGAAAGTGCGATTCTCGAGAATCGCACTTTCAAACTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-1394s1c1
Sequence:CCGGCGTTTCAATGAGAGTGGTGATCTCGAGATCACCACTCTCATTGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-316s1c1
Sequence:CCGGGCAGTTGTCTATCAACGTCTACTCGAGTAGACGTTGATAGACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-700s1c1
Sequence:CCGGCCGAGAGTTTGAAAGTGCGATCTCGAGATCGCACTTTCAAACTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-880s1c1
Sequence:CCGGGCTGGAGAAATATAAACCCTACTCGAGTAGGGTTTATATTTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014706
SART3 MISSION shRNA shRNA Plasmid DNA
squamous cell carcinoma antigen recognized by T cells 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-929s21c1
Sequence:CCGGCGAGAGTTTGAAAGTGCGATTCTCGAGAATCGCACTTTCAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-2257s1c1
Sequence:CCGGCGTGGAGTTTAAAGAAGAGAACTCGAGTTCTCTTCTTTAAACTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-2593s1c1
Sequence:CCGGCGGCATGACTATCAAAGAGAACTCGAGTTCTCTTTGATAGTCATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-986s1c1
Sequence:CCGGGCTCGCATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1108s21c1
Sequence:CCGGGCTGGAGAAATATAAACCCTACTCGAGTAGGGTTTATATTTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1622s21c1
Sequence:CCGGCGTTTCAATGAGAGTGGTGATCTCGAGATCACCACTCTCATTGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014706.2-3181s1c1
Sequence:CCGGCGAAACGAGAACACACTGTTTCTCGAGAAACAGTGTGTTCTCGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1214s21c1
Sequence:CCGGGCTCGCATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-701s1c1
Sequence:CCGGCGAGAGTTTGAAAGTGCGATTCTCGAGAATCGCACTTTCAAACTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-1394s1c1
Sequence:CCGGCGTTTCAATGAGAGTGGTGATCTCGAGATCACCACTCTCATTGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-316s1c1
Sequence:CCGGGCAGTTGTCTATCAACGTCTACTCGAGTAGACGTTGATAGACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-700s1c1
Sequence:CCGGCCGAGAGTTTGAAAGTGCGATCTCGAGATCGCACTTTCAAACTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-880s1c1
Sequence:CCGGGCTGGAGAAATATAAACCCTACTCGAGTAGGGTTTATATTTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014706
SART3 MISSION shRNA Lentiviral Transduction Particles
squamous cell carcinoma antigen recognized by T cells 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-929s21c1
Sequence:CCGGCGAGAGTTTGAAAGTGCGATTCTCGAGAATCGCACTTTCAAACTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000146268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-2257s1c1
Sequence:CCGGCGTGGAGTTTAAAGAAGAGAACTCGAGTTCTCTTCTTTAAACTCCACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000148744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-2593s1c1
Sequence:CCGGCGGCATGACTATCAAAGAGAACTCGAGTTCTCTTTGATAGTCATGCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-986s1c1
Sequence:CCGGGCTCGCATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATGCGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1108s21c1
Sequence:CCGGGCTGGAGAAATATAAACCCTACTCGAGTAGGGTTTATATTTCTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1622s21c1
Sequence:CCGGCGTTTCAATGAGAGTGGTGATCTCGAGATCACCACTCTCATTGAAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000128080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014706.2-3181s1c1
Sequence:CCGGCGAAACGAGAACACACTGTTTCTCGAGAAACAGTGTGTTCTCGTTTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014706.3-1214s21c1
Sequence:CCGGGCTCGCATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATGCGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-701s1c1
Sequence:CCGGCGAGAGTTTGAAAGTGCGATTCTCGAGAATCGCACTTTCAAACTCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000148806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-1394s1c1
Sequence:CCGGCGTTTCAATGAGAGTGGTGATCTCGAGATCACCACTCTCATTGAAACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000127760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-316s1c1
Sequence:CCGGGCAGTTGTCTATCAACGTCTACTCGAGTAGACGTTGATAGACAACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-700s1c1
Sequence:CCGGCCGAGAGTTTGAAAGTGCGATCTCGAGATCGCACTTTCAAACTCTCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000147508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014706.2-880s1c1
Sequence:CCGGGCTGGAGAAATATAAACCCTACTCGAGTAGGGTTTATATTTCTCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016926
VALIDATED
SART3 MISSION shRNA Bacterial Glycerol Stock
squamous cell carcinoma antigen recognized by T cells 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-1062s21c1
Sequence:CCGGCGCTACAGTCAGTACCTAGATCTCGAGATCTAGGTACTGACTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-996s21c1
Sequence:CCGGGCCCGTATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016926.1-3420s21c1
Sequence:CCGGGCGACCTTTGTTCTTAGGAATCTCGAGATTCCTAAGAACAAAGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-2029s21c1
Sequence:CCGGCGATAGATGTTGGTCCTCCTTCTCGAGAAGGAGGACCAACATCTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-3420s1c1
Sequence:CCGGGCGACCTTTGTTCTTAGGAATCTCGAGATTCCTAAGAACAAAGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-1062s1c1
Sequence:CCGGCGCTACAGTCAGTACCTAGATCTCGAGATCTAGGTACTGACTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-996s1c1
Sequence:CCGGGCCCGTATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-564s1c1
Sequence:CCGGCCAAACATTTGGCTAGAGTATCTCGAGATACTCTAGCCAAATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-2029s1c1
Sequence:CCGGCGATAGATGTTGGTCCTCCTTCTCGAGAAGGAGGACCAACATCTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016926
VALIDATED
SART3 MISSION shRNA shRNA Plasmid DNA
squamous cell carcinoma antigen recognized by T cells 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-1062s21c1
Sequence:CCGGCGCTACAGTCAGTACCTAGATCTCGAGATCTAGGTACTGACTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-996s21c1
Sequence:CCGGGCCCGTATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016926.1-3420s21c1
Sequence:CCGGGCGACCTTTGTTCTTAGGAATCTCGAGATTCCTAAGAACAAAGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-2029s21c1
Sequence:CCGGCGATAGATGTTGGTCCTCCTTCTCGAGAAGGAGGACCAACATCTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-3420s1c1
Sequence:CCGGGCGACCTTTGTTCTTAGGAATCTCGAGATTCCTAAGAACAAAGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-1062s1c1
Sequence:CCGGCGCTACAGTCAGTACCTAGATCTCGAGATCTAGGTACTGACTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-996s1c1
Sequence:CCGGGCCCGTATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-564s1c1
Sequence:CCGGCCAAACATTTGGCTAGAGTATCTCGAGATACTCTAGCCAAATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-2029s1c1
Sequence:CCGGCGATAGATGTTGGTCCTCCTTCTCGAGAAGGAGGACCAACATCTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016926
VALIDATED
SART3 MISSION shRNA Lentiviral Transduction Particles
squamous cell carcinoma antigen recognized by T cells 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-1062s21c1
Sequence:CCGGCGCTACAGTCAGTACCTAGATCTCGAGATCTAGGTACTGACTGTAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-996s21c1
Sequence:CCGGGCCCGTATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATACGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016926.1-3420s21c1
Sequence:CCGGGCGACCTTTGTTCTTAGGAATCTCGAGATTCCTAAGAACAAAGGTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000302448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016926.1-2029s21c1
Sequence:CCGGCGATAGATGTTGGTCCTCCTTCTCGAGAAGGAGGACCAACATCTATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-3420s1c1
Sequence:CCGGGCGACCTTTGTTCTTAGGAATCTCGAGATTCCTAAGAACAAAGGTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-1062s1c1
Sequence:CCGGCGCTACAGTCAGTACCTAGATCTCGAGATCTAGGTACTGACTGTAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-996s1c1
Sequence:CCGGGCCCGTATTCAGTTGATCTTTCTCGAGAAAGATCAACTGAATACGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-564s1c1
Sequence:CCGGCCAAACATTTGGCTAGAGTATCTCGAGATACTCTAGCCAAATGTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016926.1-2029s1c1
Sequence:CCGGCGATAGATGTTGGTCCTCCTTCTCGAGAAGGAGGACCAACATCTATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???