EMAIL THIS PAGE TO A FRIEND

SASH1

SAM and SH3 domain containing 1

149 Gene Product Result for
Synonyms: SH3D6A dJ323M4 dJ323M4.1
UniProtKB ID: O94885, Q5TGN5, Q8TAI0, Q9H7R7
Gene ID:
Mouse(70097) SAM and SH3 domain containing 1
Rat(365037) SAM and SH3 domain containing 1
cow(539603) SAM and SH3 domain containing 1
sheep(101103484) SAM and SH3 domain containing 1
Domestic Rabbit(100357394) SAM and SH3 domain containing 1
naked mole-rat(101699869) SAM and SH3 domain containing 1
domestic guinea pig(100718754) SAM and SH3 domain containing 1
chicken(421621) SAM and SH3 domain containing 1
domestic cat(101098227) SAM and SH3 domain containing 1
dog(608649) SAM and SH3 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008831 MISSION® esiRNA targeting human SASH1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015278 Rosetta Predictions human pricing
XM_001069000 Rosetta Predictions rat pricing
XM_344791 Rosetta Predictions rat pricing
NM_175155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116350 predicted 2768
2 SASI_Hs01_00116351 predicted 1176
3 SASI_Hs01_00116352 predicted 2900
4 SASI_Hs01_00116353 predicted 1733
5 SASI_Hs01_00116354 predicted 2200
6 SASI_Hs02_00347451 predicted 1584
7 SASI_Hs01_00116357 predicted 1255
8 SASI_Hs01_00116359 predicted 1756
9 SASI_Hs02_00347452 predicted 3284
10 SASI_Hs02_00347453 predicted 3056
11 SASI_Hs01_00116355 predicted 4021
12 SASI_Hs01_00116356 predicted 3182
13 SASI_Hs01_00116358 predicted 2287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326547 predicted 3499
2 SASI_Rn02_00326548 predicted 2806
3 SASI_Rn02_00326549 predicted 2042
4 SASI_Rn02_00326550 predicted 2149
5 SASI_Rn02_00326551 predicted 1695
6 SASI_Rn02_00326552 predicted 1879
7 SASI_Rn02_00326553 predicted 2440
8 SASI_Rn02_00326554 predicted 2947
9 SASI_Rn02_00326555 predicted 955
10 SASI_Rn02_00326556 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160773 predicted 2699
2 SASI_Rn01_00160774 predicted 1895
3 SASI_Rn01_00160775 predicted 7184
4 SASI_Rn01_00160776 predicted 1191
5 SASI_Rn01_00160777 predicted 1636
6 SASI_Rn01_00160778 predicted 1085
7 SASI_Rn01_00160779 predicted 1426
8 SASI_Rn01_00160780 predicted 824
9 SASI_Rn01_00160781 predicted 2493
10 SASI_Rn01_00160782 predicted 2498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095481 predicted 1741
2 SASI_Mm02_00345794 predicted 301
3 SASI_Mm01_00095483 predicted 380
4 SASI_Mm01_00095484 predicted 2994
5 SASI_Mm01_00095485 predicted 3833
6 SASI_Mm02_00345795 predicted 3540
7 SASI_Mm01_00095486 predicted 1000
8 SASI_Mm01_00095487 predicted 2731
9 SASI_Mm01_00095488 predicted 2193
10 SASI_Mm01_00095489 predicted 912
11 SASI_Mm01_00095482 predicted 3292
12 SASI_Mm01_00095490 predicted 3764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015278
SASH1 MISSION shRNA Bacterial Glycerol Stock
SAM and SH3 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-3058s1c1
Sequence:CCGGCCCTCAGATTGTACCTGAAGTCTCGAGACTTCAGGTACAATCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1737s1c1
Sequence:CCGGGCAGTAATAATTCTGACCCAACTCGAGTTGGGTCAGAATTATTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-2486s1c1
Sequence:CCGGGAAGACTTGGATGAGTTAAATCTCGAGATTTAACTCATCCAAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-3134s1c1
Sequence:CCGGGCTGTCGACAATGCATTGCTACTCGAGTAGCAATGCATTGTCGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015278.3-4252s1c1
Sequence:CCGGCCACCCTTTCACTGTGCATATCTCGAGATATGCACAGTGAAAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1282s1c1
Sequence:CCGGCAGAGTCAGAAAGAAACTAATCTCGAGATTAGTTTCTTTCTGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015278.3-7501s1c1
Sequence:CCGGGCTGTAATATACCAGTACCAACTCGAGTTGGTACTGGTATATTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1995s1c1
Sequence:CCGGCTGTAGAAAGTCTTCGCAGTTCTCGAGAACTGCGAAGACTTTCTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015278
SASH1 MISSION shRNA shRNA Plasmid DNA
SAM and SH3 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-3058s1c1
Sequence:CCGGCCCTCAGATTGTACCTGAAGTCTCGAGACTTCAGGTACAATCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1737s1c1
Sequence:CCGGGCAGTAATAATTCTGACCCAACTCGAGTTGGGTCAGAATTATTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-2486s1c1
Sequence:CCGGGAAGACTTGGATGAGTTAAATCTCGAGATTTAACTCATCCAAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-3134s1c1
Sequence:CCGGGCTGTCGACAATGCATTGCTACTCGAGTAGCAATGCATTGTCGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015278.3-4252s1c1
Sequence:CCGGCCACCCTTTCACTGTGCATATCTCGAGATATGCACAGTGAAAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1282s1c1
Sequence:CCGGCAGAGTCAGAAAGAAACTAATCTCGAGATTAGTTTCTTTCTGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015278.3-7501s1c1
Sequence:CCGGGCTGTAATATACCAGTACCAACTCGAGTTGGTACTGGTATATTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1995s1c1
Sequence:CCGGCTGTAGAAAGTCTTCGCAGTTCTCGAGAACTGCGAAGACTTTCTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015278
SASH1 MISSION shRNA Lentiviral Transduction Particles
SAM and SH3 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-3058s1c1
Sequence:CCGGCCCTCAGATTGTACCTGAAGTCTCGAGACTTCAGGTACAATCTGAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1737s1c1
Sequence:CCGGGCAGTAATAATTCTGACCCAACTCGAGTTGGGTCAGAATTATTACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-2486s1c1
Sequence:CCGGGAAGACTTGGATGAGTTAAATCTCGAGATTTAACTCATCCAAGTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000165625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-3134s1c1
Sequence:CCGGGCTGTCGACAATGCATTGCTACTCGAGTAGCAATGCATTGTCGACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015278.3-4252s1c1
Sequence:CCGGCCACCCTTTCACTGTGCATATCTCGAGATATGCACAGTGAAAGGGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1282s1c1
Sequence:CCGGCAGAGTCAGAAAGAAACTAATCTCGAGATTAGTTTCTTTCTGACTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015278.3-7501s1c1
Sequence:CCGGGCTGTAATATACCAGTACCAACTCGAGTTGGTACTGGTATATTACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015278.3-1995s1c1
Sequence:CCGGCTGTAGAAAGTCTTCGCAGTTCTCGAGAACTGCGAAGACTTTCTACAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175155
VALIDATED
SASH1 MISSION shRNA Bacterial Glycerol Stock
SAM and SH3 domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175155.3-194s1c1
Sequence:CCGGCACAGCAGTATGCAGATTATTCTCGAGAATAATCTGCATACTGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-380s21c1
Sequence:CCGGACAGCAGTATGCAGATTATTACTCGAGTAATAATCTGCATACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-1812s1c1
Sequence:CCGGCGGCACGTTCAAGTTCATCTACTCGAGTAGATGAACTTGAACGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175155.4-1928s21c1
Sequence:CCGGAGGAGATATCATTGACATAATCTCGAGATTATGTCAATGATATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-5287s1c1
Sequence:CCGGCGCTAGTTCATTTGGGTTATTCTCGAGAATAACCCAAATGAACTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175155.3-3471s1c1
Sequence:CCGGGCTGACGGAAATCTGCAGAAACTCGAGTTTCTGCAGATTTCCGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-2807s1c1
Sequence:CCGGCGCCTGTTAAACCCGGCTTAACTCGAGTTAAGCCGGGTTTAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-1443s21c1
Sequence:CCGGCTGCATGTTGGCAGTAATAATCTCGAGATTATTACTGCCAACATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175155.4-1997s21c1
Sequence:CCGGCGGCACGTTCAAGTTCATCTACTCGAGTAGATGAACTTGAACGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-2437s21c1
Sequence:CCGGCGTCCACGGAGTCCAACTTAACTCGAGTTAAGTTGGACTCCGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175155
VALIDATED
SASH1 MISSION shRNA shRNA Plasmid DNA
SAM and SH3 domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175155.3-194s1c1
Sequence:CCGGCACAGCAGTATGCAGATTATTCTCGAGAATAATCTGCATACTGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-380s21c1
Sequence:CCGGACAGCAGTATGCAGATTATTACTCGAGTAATAATCTGCATACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-1812s1c1
Sequence:CCGGCGGCACGTTCAAGTTCATCTACTCGAGTAGATGAACTTGAACGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175155.4-1928s21c1
Sequence:CCGGAGGAGATATCATTGACATAATCTCGAGATTATGTCAATGATATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-5287s1c1
Sequence:CCGGCGCTAGTTCATTTGGGTTATTCTCGAGAATAACCCAAATGAACTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175155.3-3471s1c1
Sequence:CCGGGCTGACGGAAATCTGCAGAAACTCGAGTTTCTGCAGATTTCCGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-2807s1c1
Sequence:CCGGCGCCTGTTAAACCCGGCTTAACTCGAGTTAAGCCGGGTTTAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-1443s21c1
Sequence:CCGGCTGCATGTTGGCAGTAATAATCTCGAGATTATTACTGCCAACATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175155.4-1997s21c1
Sequence:CCGGCGGCACGTTCAAGTTCATCTACTCGAGTAGATGAACTTGAACGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-2437s21c1
Sequence:CCGGCGTCCACGGAGTCCAACTTAACTCGAGTTAAGTTGGACTCCGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175155
VALIDATED
SASH1 MISSION shRNA Lentiviral Transduction Particles
SAM and SH3 domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175155.3-194s1c1
Sequence:CCGGCACAGCAGTATGCAGATTATTCTCGAGAATAATCTGCATACTGCTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-380s21c1
Sequence:CCGGACAGCAGTATGCAGATTATTACTCGAGTAATAATCTGCATACTGCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-1812s1c1
Sequence:CCGGCGGCACGTTCAAGTTCATCTACTCGAGTAGATGAACTTGAACGTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175155.4-1928s21c1
Sequence:CCGGAGGAGATATCATTGACATAATCTCGAGATTATGTCAATGATATCTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-5287s1c1
Sequence:CCGGCGCTAGTTCATTTGGGTTATTCTCGAGAATAACCCAAATGAACTAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175155.3-3471s1c1
Sequence:CCGGGCTGACGGAAATCTGCAGAAACTCGAGTTTCTGCAGATTTCCGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175155.3-2807s1c1
Sequence:CCGGCGCCTGTTAAACCCGGCTTAACTCGAGTTAAGCCGGGTTTAACAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-1443s21c1
Sequence:CCGGCTGCATGTTGGCAGTAATAATCTCGAGATTATTACTGCCAACATGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175155.4-1997s21c1
Sequence:CCGGCGGCACGTTCAAGTTCATCTACTCGAGTAGATGAACTTGAACGTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175155.4-2437s21c1
Sequence:CCGGCGTCCACGGAGTCCAACTTAACTCGAGTTAAGTTGGACTCCGTGGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???