EMAIL THIS PAGE TO A FRIEND

SATB2

SATB homeobox 2

232 Gene Product Result for
UniProtKB ID: Q9UPW6, A8K5Z8, Q4V763
Gene ID:
Human(23314) Summary: This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
Mouse(212712) special AT-rich sequence binding protein 2
Rat(501145) SATB homeobox 2
Zebrafish(563435) SATB homeobox 2
Horse(100070721) SATB homeobox 2
domestic cat(101090378) SATB homeobox 2
dog(100687238) SATB homeobox 2
chicken(424063) SATB homeobox 2
cow(541192) SATB homeobox 2
sheep(101102623) SATB homeobox 2
naked mole-rat(101698750) SATB homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4627 Anti-SATB2 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4629 Anti-SATB2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
ABE600 Anti-SATB2 Antibody Detect Special AT-rich sequence-binding protein 2 using this rabbit polyclonal antibody, Anti-SATB2 Antibody validated for use in western blotting, IHC (Paraffin) & Immunofluorescence. human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA001042 Anti-SATB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA029543 Anti-SATB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90682 Monoclonal Anti-SATB2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0323, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90680 Monoclonal Anti-SATB2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0321, purified immunoglobulin, buffered aqueous glycerol solution rat, human
immunohistochemistry, western blot pricing
AMAB90679 Monoclonal Anti-SATB2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0320, purified immunoglobulin, buffered aqueous glycerol solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90678 Monoclonal Anti-SATB2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0319, purified immunoglobulin, buffered aqueous glycerol solution human, rat
immunohistochemistry, western blot pricing
AMAB90635 Monoclonal Anti-SATB2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0276, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015265 Rosetta Predictions human pricing
NM_001109306 Rosetta Predictions rat pricing
NM_139146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347417 predicted 859
2 SASI_Hs01_00206624 predicted 886
3 SASI_Hs02_00347418 predicted 1052
4 SASI_Hs01_00206627 predicted 999
5 SASI_Hs02_00347419 predicted 1588
6 SASI_Hs01_00206629 predicted 749
7 SASI_Hs01_00206630 predicted 307
8 SASI_Hs01_00206631 predicted 1590
9 SASI_Hs01_00206632 predicted 836
10 SASI_Hs01_00206633 predicted 1541
11 SASI_Hs01_00206625 predicted 697
12 SASI_Hs01_00206626 predicted 744
13 SASI_Hs01_00206628 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247124 predicted 1457
2 SASI_Rn02_00247125 predicted 1108
3 SASI_Rn02_00247126 predicted 725
4 SASI_Rn02_00247127 predicted 870
5 SASI_Rn02_00247128 predicted 1402
6 SASI_Rn02_00247129 predicted 1683
7 SASI_Rn02_00247130 predicted 1032
8 SASI_Rn02_00247131 predicted 743
9 SASI_Rn02_00247132 predicted 885
10 SASI_Rn02_00247133 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148281 predicted 1462
2 SASI_Mm01_00148282 predicted 997
3 SASI_Mm01_00148283 predicted 732
4 SASI_Mm01_00148284 predicted 1321
5 SASI_Mm01_00148285 predicted 1739
6 SASI_Mm01_00148286 predicted 870
7 SASI_Mm01_00148287 predicted 1678
8 SASI_Mm02_00339893 predicted 441
9 SASI_Mm01_00148288 predicted 737
10 SASI_Mm01_00148289 predicted 737
11 SASI_Mm01_00148280 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015265
VALIDATED
SATB2 MISSION shRNA Bacterial Glycerol Stock
SATB homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-1335s1c1
Sequence:CCGGGCCATGCAGAATTTCCTCAATCTCGAGATTGAGGAAATTCTGCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015265.1-2266s1c1
Sequence:CCGGCTGCCGAAATTGACCAGAGATCTCGAGATCTCTGGTCAATTTCGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015265.1-1542s1c1
Sequence:CCGGGCCATTTATGACGAGATCCAACTCGAGTTGGATCTCGTCATAAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-618s1c1
Sequence:CCGGGCCTTAAAGGAACTGCTCAAACTCGAGTTTGAGCAGTTCCTTTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-506s1c1
Sequence:CCGGCGACATGCTACAAGATGTCTACTCGAGTAGACATCTTGTAGCATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015265
VALIDATED
SATB2 MISSION shRNA shRNA Plasmid DNA
SATB homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-1335s1c1
Sequence:CCGGGCCATGCAGAATTTCCTCAATCTCGAGATTGAGGAAATTCTGCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015265.1-2266s1c1
Sequence:CCGGCTGCCGAAATTGACCAGAGATCTCGAGATCTCTGGTCAATTTCGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015265.1-1542s1c1
Sequence:CCGGGCCATTTATGACGAGATCCAACTCGAGTTGGATCTCGTCATAAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-618s1c1
Sequence:CCGGGCCTTAAAGGAACTGCTCAAACTCGAGTTTGAGCAGTTCCTTTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-506s1c1
Sequence:CCGGCGACATGCTACAAGATGTCTACTCGAGTAGACATCTTGTAGCATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015265
VALIDATED
SATB2 MISSION shRNA Lentiviral Transduction Particles
SATB homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-1335s1c1
Sequence:CCGGGCCATGCAGAATTTCCTCAATCTCGAGATTGAGGAAATTCTGCATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015265.1-2266s1c1
Sequence:CCGGCTGCCGAAATTGACCAGAGATCTCGAGATCTCTGGTCAATTTCGGCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015265.1-1542s1c1
Sequence:CCGGGCCATTTATGACGAGATCCAACTCGAGTTGGATCTCGTCATAAATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-618s1c1
Sequence:CCGGGCCTTAAAGGAACTGCTCAAACTCGAGTTTGAGCAGTTCCTTTAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015265.1-506s1c1
Sequence:CCGGCGACATGCTACAAGATGTCTACTCGAGTAGACATCTTGTAGCATGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139146
VALIDATED
SATB2 MISSION shRNA Bacterial Glycerol Stock
SATB homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139146.1-1501s1c1
Sequence:CCGGGCGTCTCAGTCTCTTCTAGTACTCGAGTACTAGAAGAGACTGAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-1453s1c1
Sequence:CCGGCAGGGATTATTGTCAGAGATACTCGAGTATCTCTGACAATAATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-734s1c1
Sequence:CCGGCGCTGAAGATCCAATTACAAACTCGAGTTTGTAATTGGATCTTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-2134s1c1
Sequence:CCGGCGCACAAAGATCTCTTTGGAACTCGAGTTCCAAAGAGATCTTTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139146.1-2807s1c1
Sequence:CCGGCCCACGAGATAAATGAAGGAACTCGAGTTCCTTCATTTATCTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139146
VALIDATED
SATB2 MISSION shRNA shRNA Plasmid DNA
SATB homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139146.1-1501s1c1
Sequence:CCGGGCGTCTCAGTCTCTTCTAGTACTCGAGTACTAGAAGAGACTGAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-1453s1c1
Sequence:CCGGCAGGGATTATTGTCAGAGATACTCGAGTATCTCTGACAATAATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-734s1c1
Sequence:CCGGCGCTGAAGATCCAATTACAAACTCGAGTTTGTAATTGGATCTTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-2134s1c1
Sequence:CCGGCGCACAAAGATCTCTTTGGAACTCGAGTTCCAAAGAGATCTTTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139146.1-2807s1c1
Sequence:CCGGCCCACGAGATAAATGAAGGAACTCGAGTTCCTTCATTTATCTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139146
VALIDATED
SATB2 MISSION shRNA Lentiviral Transduction Particles
SATB homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139146.1-1501s1c1
Sequence:CCGGGCGTCTCAGTCTCTTCTAGTACTCGAGTACTAGAAGAGACTGAGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-1453s1c1
Sequence:CCGGCAGGGATTATTGTCAGAGATACTCGAGTATCTCTGACAATAATCCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-734s1c1
Sequence:CCGGCGCTGAAGATCCAATTACAAACTCGAGTTTGTAATTGGATCTTCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139146.1-2134s1c1
Sequence:CCGGCGCACAAAGATCTCTTTGGAACTCGAGTTCCAAAGAGATCTTTGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139146.1-2807s1c1
Sequence:CCGGCCCACGAGATAAATGAAGGAACTCGAGTTCCTTCATTTATCTCGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)