EMAIL THIS PAGE TO A FRIEND

SBDS

Shwachman-Bodian-Diamond syndrome

54 Gene Product Result for
Synonyms: SDS SWDS
UniProtKB ID: Q9Y3A5, A8K0P4, Q96FX0, Q9NV53
Gene ID:
Human(51119) Summary: This gene encodes a member of a highly conserved protein family that exists from archaea to vertebrates and plants. The encoded protein may function in RNA metabolism. Mutations within this gene are associated with Shwachman-Bodian-Diamond syndrome. An alternative transcript has been described, but its biological nature has not been determined. This gene has a closely linked pseudogene that is distally located. [provided by RefSeq, Jul 2008]
Mouse(66711) Shwachman-Bodian-Diamond syndrome homolog (human)
Rat(288615) Shwachman-Bodian-Diamond syndrome
cow(513237) Shwachman-Bodian-Diamond syndrome
sheep(101111067) Shwachman-Bodian-Diamond syndrome
domestic guinea pig(100734229) Shwachman-Bodian-Diamond syndrome
naked mole-rat(101714934) Shwachman-Bodian-Diamond syndrome
Zebrafish(394096) Shwachman-Bodian-Diamond syndrome
domestic cat(101100775) Shwachman-Bodian-Diamond syndrome
dog(607017) Shwachman-Bodian-Diamond syndrome
chicken(417477) Shwachman-Bodian-Diamond syndrome
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016038 Rosetta Predictions human pricing
NM_001008289 Rosetta Predictions rat pricing
NM_023248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073894 predicted 364
2 SASI_Hs01_00073895 predicted 833
3 SASI_Hs01_00073896 predicted 757
4 SASI_Hs01_00073897 predicted 866
5 SASI_Hs01_00073898 predicted 869
6 SASI_Hs02_00348751 predicted 701
7 SASI_Hs02_00348752 predicted 689
8 SASI_Hs02_00348753 predicted 707
9 SASI_Hs02_00348754 predicted 642
10 SASI_Hs01_00073899 predicted 485
11 SASI_Hs01_00073893 predicted 455
12 SASI_Hs01_00073900 predicted 896
13 SASI_Hs01_00073901 predicted 563
14 SASI_Hs01_00073902 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076833 predicted 398
2 SASI_Rn01_00076834 predicted 277
3 SASI_Rn01_00076835 predicted 429
4 SASI_Rn01_00076836 predicted 293
5 SASI_Rn01_00076837 predicted 356
6 SASI_Rn01_00076838 predicted 1143
7 SASI_Rn01_00076839 predicted 433
8 SASI_Rn01_00076840 predicted 535
9 SASI_Rn01_00076841 predicted 1137
10 SASI_Rn02_00198992 predicted 230
11 SASI_Rn01_00076832 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029861 predicted 498
2 SASI_Mm01_00029862 predicted 331
3 SASI_Mm01_00029864 predicted 772
4 SASI_Mm02_00327001 predicted 502
5 SASI_Mm01_00029865 predicted 585
6 SASI_Mm01_00029866 predicted 531
7 SASI_Mm01_00029867 predicted 391
8 SASI_Mm01_00029868 predicted 973
9 SASI_Mm01_00029869 predicted 268
10 SASI_Mm02_00327002 predicted 196
11 SASI_Mm01_00029860 predicted 287
12 SASI_Mm01_00029863 predicted 201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016038
VALIDATED
SBDS MISSION shRNA Bacterial Glycerol Stock
Shwachman-Bodian-Diamond syndrome
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-418s21c1
Sequence:CCGGTGACCAAACTGAAATCTGTAACTCGAGTTACAGATTTCAGTTTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016038.2-792s1c1
Sequence:CCGGGCCAACAGTTAGAAATCGTATCTCGAGATACGATTTCTAACTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-894s21c1
Sequence:CCGGTCAATCTGAAAGATGTAGAAGCTCGAGCTTCTACATCTTTCAGATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016038.2-1013s1c1
Sequence:CCGGGCCAAATACTTGCTTAAACTACTCGAGTAGTTTAAGCAAGTATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-519s1c1
Sequence:CCGGCAACTATTGTGGCAGACAAATCTCGAGATTTGTCTGCCACAATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-707s1c1
Sequence:CCGGCGGTTCATCCTTCCAGTCAATCTCGAGATTGACTGGAAGGATGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-405s1c1
Sequence:CCGGCGTTTGGAACAGATGACCAAACTCGAGTTTGGTCATCTGTTCCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-562s21c1
Sequence:CCGGACCATACACCGTGATCCTTATCTCGAGATAAGGATCACGGTGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-835s21c1
Sequence:CCGGCCGAGAAATTGATGAGCTAATCTCGAGATTAGCTCATCAATTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-365s21c1
Sequence:CCGGTCTAAAGGTCAGGTTGCCAAACTCGAGTTTGGCAACCTGACCTTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-792s21c1
Sequence:CCGGGCCAACAGTTAGAAATCGTATCTCGAGATACGATTTCTAACTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016038
VALIDATED
SBDS MISSION shRNA shRNA Plasmid DNA
Shwachman-Bodian-Diamond syndrome
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-418s21c1
Sequence:CCGGTGACCAAACTGAAATCTGTAACTCGAGTTACAGATTTCAGTTTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016038.2-792s1c1
Sequence:CCGGGCCAACAGTTAGAAATCGTATCTCGAGATACGATTTCTAACTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-894s21c1
Sequence:CCGGTCAATCTGAAAGATGTAGAAGCTCGAGCTTCTACATCTTTCAGATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016038.2-1013s1c1
Sequence:CCGGGCCAAATACTTGCTTAAACTACTCGAGTAGTTTAAGCAAGTATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-519s1c1
Sequence:CCGGCAACTATTGTGGCAGACAAATCTCGAGATTTGTCTGCCACAATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-707s1c1
Sequence:CCGGCGGTTCATCCTTCCAGTCAATCTCGAGATTGACTGGAAGGATGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-405s1c1
Sequence:CCGGCGTTTGGAACAGATGACCAAACTCGAGTTTGGTCATCTGTTCCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-562s21c1
Sequence:CCGGACCATACACCGTGATCCTTATCTCGAGATAAGGATCACGGTGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-835s21c1
Sequence:CCGGCCGAGAAATTGATGAGCTAATCTCGAGATTAGCTCATCAATTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-365s21c1
Sequence:CCGGTCTAAAGGTCAGGTTGCCAAACTCGAGTTTGGCAACCTGACCTTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-792s21c1
Sequence:CCGGGCCAACAGTTAGAAATCGTATCTCGAGATACGATTTCTAACTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016038
VALIDATED
SBDS MISSION shRNA Lentiviral Transduction Particles
Shwachman-Bodian-Diamond syndrome
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-418s21c1
Sequence:CCGGTGACCAAACTGAAATCTGTAACTCGAGTTACAGATTTCAGTTTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016038.2-792s1c1
Sequence:CCGGGCCAACAGTTAGAAATCGTATCTCGAGATACGATTTCTAACTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-894s21c1
Sequence:CCGGTCAATCTGAAAGATGTAGAAGCTCGAGCTTCTACATCTTTCAGATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016038.2-1013s1c1
Sequence:CCGGGCCAAATACTTGCTTAAACTACTCGAGTAGTTTAAGCAAGTATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-519s1c1
Sequence:CCGGCAACTATTGTGGCAGACAAATCTCGAGATTTGTCTGCCACAATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-707s1c1
Sequence:CCGGCGGTTCATCCTTCCAGTCAATCTCGAGATTGACTGGAAGGATGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016038.2-405s1c1
Sequence:CCGGCGTTTGGAACAGATGACCAAACTCGAGTTTGGTCATCTGTTCCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-562s21c1
Sequence:CCGGACCATACACCGTGATCCTTATCTCGAGATAAGGATCACGGTGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-835s21c1
Sequence:CCGGCCGAGAAATTGATGAGCTAATCTCGAGATTAGCTCATCAATTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-365s21c1
Sequence:CCGGTCTAAAGGTCAGGTTGCCAAACTCGAGTTTGGCAACCTGACCTTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016038.2-792s21c1
Sequence:CCGGGCCAACAGTTAGAAATCGTATCTCGAGATACGATTTCTAACTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023248
VALIDATED
SBDS MISSION shRNA Bacterial Glycerol Stock
Shwachman-Bodian-Diamond syndrome
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023248.1-399s1c1
Sequence:CCGGGAAGTTCAAGTGTCAGATAAACTCGAGTTTATCTGACACTTGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023248.1-977s1c1
Sequence:CCGGGCCACTTTCCATCTTGTGTTACTCGAGTAACACAAGATGGAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023248.1-280s1c1
Sequence:CCGGAGACCCATTCAGTGTTTGTAACTCGAGTTACAAACACTGAATGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023248.1-397s1c1
Sequence:CCGGGAGAAGTTCAAGTGTCAGATACTCGAGTATCTGACACTTGAACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023248.1-202s1c1
Sequence:CCGGGCTTCGAAATCGCCTGCTATACTCGAGTATAGCAGGCGATTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-202s21c1
Sequence:CCGGGCTTCGAAATCGCCTGCTATACTCGAGTATAGCAGGCGATTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-397s21c1
Sequence:CCGGGAGAAGTTCAAGTGTCAGATACTCGAGTATCTGACACTTGAACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-778s21c1
Sequence:CCGGGAGAAATTGATGAGCTAATAACTCGAGTTATTAGCTCATCAATTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-541s21c1
Sequence:CCGGACATCCACTACTCCGTGAAACCTCGAGGTTTCACGGAGTAGTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-977s21c1
Sequence:CCGGGCCACTTTCCATCTTGTGTTACTCGAGTAACACAAGATGGAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023248
VALIDATED
SBDS MISSION shRNA shRNA Plasmid DNA
Shwachman-Bodian-Diamond syndrome
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023248.1-399s1c1
Sequence:CCGGGAAGTTCAAGTGTCAGATAAACTCGAGTTTATCTGACACTTGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023248.1-977s1c1
Sequence:CCGGGCCACTTTCCATCTTGTGTTACTCGAGTAACACAAGATGGAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023248.1-280s1c1
Sequence:CCGGAGACCCATTCAGTGTTTGTAACTCGAGTTACAAACACTGAATGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023248.1-397s1c1
Sequence:CCGGGAGAAGTTCAAGTGTCAGATACTCGAGTATCTGACACTTGAACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023248.1-202s1c1
Sequence:CCGGGCTTCGAAATCGCCTGCTATACTCGAGTATAGCAGGCGATTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-202s21c1
Sequence:CCGGGCTTCGAAATCGCCTGCTATACTCGAGTATAGCAGGCGATTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-397s21c1
Sequence:CCGGGAGAAGTTCAAGTGTCAGATACTCGAGTATCTGACACTTGAACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-778s21c1
Sequence:CCGGGAGAAATTGATGAGCTAATAACTCGAGTTATTAGCTCATCAATTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-541s21c1
Sequence:CCGGACATCCACTACTCCGTGAAACCTCGAGGTTTCACGGAGTAGTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-977s21c1
Sequence:CCGGGCCACTTTCCATCTTGTGTTACTCGAGTAACACAAGATGGAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023248
VALIDATED
SBDS MISSION shRNA Lentiviral Transduction Particles
Shwachman-Bodian-Diamond syndrome
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023248.1-399s1c1
Sequence:CCGGGAAGTTCAAGTGTCAGATAAACTCGAGTTTATCTGACACTTGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023248.1-977s1c1
Sequence:CCGGGCCACTTTCCATCTTGTGTTACTCGAGTAACACAAGATGGAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023248.1-280s1c1
Sequence:CCGGAGACCCATTCAGTGTTTGTAACTCGAGTTACAAACACTGAATGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023248.1-397s1c1
Sequence:CCGGGAGAAGTTCAAGTGTCAGATACTCGAGTATCTGACACTTGAACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023248.1-202s1c1
Sequence:CCGGGCTTCGAAATCGCCTGCTATACTCGAGTATAGCAGGCGATTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-202s21c1
Sequence:CCGGGCTTCGAAATCGCCTGCTATACTCGAGTATAGCAGGCGATTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-397s21c1
Sequence:CCGGGAGAAGTTCAAGTGTCAGATACTCGAGTATCTGACACTTGAACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-778s21c1
Sequence:CCGGGAGAAATTGATGAGCTAATAACTCGAGTTATTAGCTCATCAATTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-541s21c1
Sequence:CCGGACATCCACTACTCCGTGAAACCTCGAGGTTTCACGGAGTAGTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023248.1-977s21c1
Sequence:CCGGGCCACTTTCCATCTTGTGTTACTCGAGTAACACAAGATGGAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)