EMAIL THIS PAGE TO A FRIEND

SCAMP2

secretory carrier membrane protein 2

54 Gene Product Result for
UniProtKB ID: O15127, B2RDF0, Q9BQE8
Gene ID:
Human(10066) Summary: This gene product belongs to the SCAMP family of proteins which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that the SCAMPs may function at the same site during vesicular transport rather than in separate pathways. [provided by RefSeq, Jul 2008]
Mouse(24044) secretory carrier membrane protein 2
Rat(65168) secretory carrier membrane protein 2
cow(534312) secretory carrier membrane protein 2
sheep(101108166) secretory carrier membrane protein 2
domestic guinea pig(100714543) secretory carrier membrane protein 2
naked mole-rat(101712864) secretory carrier membrane protein 2
Zebrafish(406687) secretory carrier membrane protein 2
chicken(769853) secretory carrier membrane protein 2
domestic cat(101082572) secretory carrier membrane protein 2
dog(487652) secretory carrier membrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0279 AQUA Peptide TGASFQQAQEEFSQGIFSS[R] cow, human, mouse, rat pricing
AQ0278 AQUA Peptide ELQNTAANLHV[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005697 Rosetta Predictions human pricing
NM_023955 Rosetta Predictions rat pricing
NM_022813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213978 predicted 754
2 SASI_Hs01_00213979 predicted 505
3 SASI_Hs01_00213980 predicted 844
4 SASI_Hs01_00213981 predicted 253
5 SASI_Hs01_00213982 predicted 821
6 SASI_Hs01_00213983 predicted 809
7 SASI_Hs02_00340098 predicted 208
8 SASI_Hs01_00213984 predicted 849
9 SASI_Hs01_00213987 predicted 403
10 SASI_Hs02_00340099 predicted 399
11 SASI_Hs01_00213985 predicted 807
12 SASI_Hs01_00213986 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032094 predicted 1500
2 SASI_Rn01_00032095 predicted 534
3 SASI_Rn01_00032097 predicted 532
4 SASI_Rn01_00032098 predicted 1539
5 SASI_Rn01_00032099 predicted 419
6 SASI_Rn01_00032100 predicted 1571
7 SASI_Rn01_00032101 predicted 228
8 SASI_Rn01_00032102 predicted 217
9 SASI_Rn02_00263760 predicted 1046
10 SASI_Rn01_00032103 predicted 1536
11 SASI_Rn01_00032096 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047664 predicted 541
2 SASI_Mm01_00047665 predicted 239
3 SASI_Mm02_00326658 predicted 491
4 SASI_Mm01_00047666 predicted 1522
5 SASI_Mm01_00047668 predicted 226
6 SASI_Mm01_00047669 predicted 435
7 SASI_Mm01_00047670 predicted 544
8 SASI_Mm01_00047671 predicted 525
9 SASI_Mm01_00047672 predicted 546
10 SASI_Mm02_00326659 predicted 306
11 SASI_Mm01_00047667 predicted 996
12 SASI_Mm01_00047673 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005697
VALIDATED
SCAMP2 MISSION shRNA Bacterial Glycerol Stock
secretory carrier membrane protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-512s1c1
Sequence:CCGGGCGGATATGCAAGATGCTCTACTCGAGTAGAGCATCTTGCATATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005697.3-524s1c1
Sequence:CCGGGATGCTCTACTATCTGTGGATCTCGAGATCCACAGATAGTAGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-515s1c1
Sequence:CCGGGATATGCAAGATGCTCTACTACTCGAGTAGTAGAGCATCTTGCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-464s21c1
Sequence:CCGGGCCCTGCTTCTATCAGGATTTCTCGAGAAATCCTGATAGAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-515s21c1
Sequence:CCGGGATATGCAAGATGCTCTACTACTCGAGTAGTAGAGCATCTTGCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-827s21c1
Sequence:CCGGGTCTACACTGGATAATCATTCCTCGAGGAATGATTATCCAGTGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-392s1c1
Sequence:CCGGGCAGAACACTGTAGCCAACTTCTCGAGAAGTTGGCTACAGTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005697.3-700s1c1
Sequence:CCGGCCTTTAGGTCCGACAACTCTTCTCGAGAAGAGTTGTCGGACCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-392s21c1
Sequence:CCGGGCAGAACACTGTAGCCAACTTCTCGAGAAGTTGGCTACAGTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-1120s21c1
Sequence:CCGGTTTCCGTGGGTGCCTTATGTGCTCGAGCACATAAGGCACCCACGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005697
VALIDATED
SCAMP2 MISSION shRNA shRNA Plasmid DNA
secretory carrier membrane protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-512s1c1
Sequence:CCGGGCGGATATGCAAGATGCTCTACTCGAGTAGAGCATCTTGCATATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005697.3-524s1c1
Sequence:CCGGGATGCTCTACTATCTGTGGATCTCGAGATCCACAGATAGTAGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-515s1c1
Sequence:CCGGGATATGCAAGATGCTCTACTACTCGAGTAGTAGAGCATCTTGCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-464s21c1
Sequence:CCGGGCCCTGCTTCTATCAGGATTTCTCGAGAAATCCTGATAGAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-515s21c1
Sequence:CCGGGATATGCAAGATGCTCTACTACTCGAGTAGTAGAGCATCTTGCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-827s21c1
Sequence:CCGGGTCTACACTGGATAATCATTCCTCGAGGAATGATTATCCAGTGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-392s1c1
Sequence:CCGGGCAGAACACTGTAGCCAACTTCTCGAGAAGTTGGCTACAGTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005697.3-700s1c1
Sequence:CCGGCCTTTAGGTCCGACAACTCTTCTCGAGAAGAGTTGTCGGACCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-392s21c1
Sequence:CCGGGCAGAACACTGTAGCCAACTTCTCGAGAAGTTGGCTACAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-1120s21c1
Sequence:CCGGTTTCCGTGGGTGCCTTATGTGCTCGAGCACATAAGGCACCCACGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005697
VALIDATED
SCAMP2 MISSION shRNA Lentiviral Transduction Particles
secretory carrier membrane protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-512s1c1
Sequence:CCGGGCGGATATGCAAGATGCTCTACTCGAGTAGAGCATCTTGCATATCCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005697.3-524s1c1
Sequence:CCGGGATGCTCTACTATCTGTGGATCTCGAGATCCACAGATAGTAGAGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-515s1c1
Sequence:CCGGGATATGCAAGATGCTCTACTACTCGAGTAGTAGAGCATCTTGCATATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-464s21c1
Sequence:CCGGGCCCTGCTTCTATCAGGATTTCTCGAGAAATCCTGATAGAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-515s21c1
Sequence:CCGGGATATGCAAGATGCTCTACTACTCGAGTAGTAGAGCATCTTGCATATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-827s21c1
Sequence:CCGGGTCTACACTGGATAATCATTCCTCGAGGAATGATTATCCAGTGTAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005697.3-392s1c1
Sequence:CCGGGCAGAACACTGTAGCCAACTTCTCGAGAAGTTGGCTACAGTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005697.3-700s1c1
Sequence:CCGGCCTTTAGGTCCGACAACTCTTCTCGAGAAGAGTTGTCGGACCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-392s21c1
Sequence:CCGGGCAGAACACTGTAGCCAACTTCTCGAGAAGTTGGCTACAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005697.3-1120s21c1
Sequence:CCGGTTTCCGTGGGTGCCTTATGTGCTCGAGCACATAAGGCACCCACGGAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022813
VALIDATED
SCAMP2 MISSION shRNA Bacterial Glycerol Stock
secretory carrier membrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-788s1c1
Sequence:CCGGTCCAGTTGATTGGCTTGCCTACTCGAGTAGGCAAGCCAATCAACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022813.2-1978s1c1
Sequence:CCGGGCCTTCTTTCTGAGGGTTCTTCTCGAGAAGAACCCTCAGAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-696s1c1
Sequence:CCGGCCGACCCATCTACAAGGCTTTCTCGAGAAAGCCTTGTAGATGGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-405s1c1
Sequence:CCGGGCAGAACACTGCAGCGAATTTCTCGAGAAATTCGCTGCAGTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022813.2-832s1c1
Sequence:CCGGGCAGCCCTATCTACGATGAAACTCGAGTTTCATCGTAGATAGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022813
VALIDATED
SCAMP2 MISSION shRNA shRNA Plasmid DNA
secretory carrier membrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-788s1c1
Sequence:CCGGTCCAGTTGATTGGCTTGCCTACTCGAGTAGGCAAGCCAATCAACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022813.2-1978s1c1
Sequence:CCGGGCCTTCTTTCTGAGGGTTCTTCTCGAGAAGAACCCTCAGAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-696s1c1
Sequence:CCGGCCGACCCATCTACAAGGCTTTCTCGAGAAAGCCTTGTAGATGGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-405s1c1
Sequence:CCGGGCAGAACACTGCAGCGAATTTCTCGAGAAATTCGCTGCAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022813.2-832s1c1
Sequence:CCGGGCAGCCCTATCTACGATGAAACTCGAGTTTCATCGTAGATAGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022813
VALIDATED
SCAMP2 MISSION shRNA Lentiviral Transduction Particles
secretory carrier membrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-788s1c1
Sequence:CCGGTCCAGTTGATTGGCTTGCCTACTCGAGTAGGCAAGCCAATCAACTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022813.2-1978s1c1
Sequence:CCGGGCCTTCTTTCTGAGGGTTCTTCTCGAGAAGAACCCTCAGAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-696s1c1
Sequence:CCGGCCGACCCATCTACAAGGCTTTCTCGAGAAAGCCTTGTAGATGGGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022813.2-405s1c1
Sequence:CCGGGCAGAACACTGCAGCGAATTTCTCGAGAAATTCGCTGCAGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022813.2-832s1c1
Sequence:CCGGGCAGCCCTATCTACGATGAAACTCGAGTTTCATCGTAGATAGGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)