EMAIL THIS PAGE TO A FRIEND

SCAND1

SCAN domain containing 1

76 Gene Product Result for
Synonyms: RAZ1 SDP1
UniProtKB ID: P57086, Q6IAG7
Gene ID:
Human(51282) Summary: This gene encodes a SCAN box domain-containing protein. The SCAN domain is a highly conserved, leucine-rich motif of approximately 60 aa originally found within a subfamily of zinc finger proteins. This gene belongs to a family of genes that encode an isolated SCAN domain, but no zinc finger motif. This protein binds to and may regulate the function of the transcription factor myeloid zinc finger 1B. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Mouse(19018) SCAN domain-containing 1
Rat(362252) SCAN domain-containing 1
dog(609014) SCAN domain containing 1
domestic cat(101087147) SCAN domain containing 1
domestic guinea pig(100736009) SCAN domain containing 1
naked mole-rat(101722533) SCAN domain containing 1
cow(513983) SCAN domain containing 1
sheep(101121366) SCAN domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149721 MISSION® esiRNA esiRNA human SCAND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016558 Rosetta Predictions human pricing
NM_033630 Rosetta Predictions human pricing
NM_001108599 Rosetta Predictions rat pricing
NM_020255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349677 predicted 466
2 SASI_Hs02_00349678 predicted 387
3 SASI_Hs01_00120946 predicted 513
4 SASI_Hs02_00349679 predicted 466
5 SASI_Hs01_00120947 predicted 450
6 SASI_Hs02_00349680 predicted 377
7 SASI_Hs01_00120951 predicted 456
8 SASI_Hs02_00349681 predicted 382
9 SASI_Hs02_00349682 predicted 436
10 SASI_Hs02_00349683 predicted 625
11 SASI_Hs01_00120948 predicted 467
12 SASI_Hs01_00120949 predicted 631
13 SASI_Hs01_00120950 predicted 546
14 SASI_Hs01_00120952 predicted 531
15 SASI_Hs01_00120953 predicted 638
16 SASI_Hs01_00120954 predicted 525
17 SASI_Hs01_00120955 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361436 predicted 362
2 SASI_Hs02_00361437 predicted 273
3 SASI_Hs01_00198756 predicted 405
4 SASI_Hs02_00361438 predicted 360
5 SASI_Hs01_00198757 predicted 337
6 SASI_Hs02_00361439 predicted 277
7 SASI_Hs01_00198761 predicted 349
8 SASI_Hs02_00361440 predicted 273
9 SASI_Hs02_00361441 predicted 336
10 SASI_Hs02_00361442 predicted 517
11 SASI_Hs01_00198758 predicted 363
12 SASI_Hs01_00198759 predicted 529
13 SASI_Hs01_00198760 predicted 435
14 SASI_Hs01_00198762 predicted 429
15 SASI_Hs01_00198763 predicted 530
16 SASI_Hs01_00198764 predicted 414
17 SASI_Hs01_00198765 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240229 predicted 390
2 SASI_Rn02_00240230 predicted 399
3 SASI_Rn02_00240231 predicted 485
4 SASI_Rn02_00240232 predicted 386
5 SASI_Rn02_00240233 predicted 475
6 SASI_Rn02_00240234 predicted 314
7 SASI_Rn02_00240235 predicted 391
8 SASI_Rn02_00240236 predicted 331
9 SASI_Rn02_00240237 predicted 393
10 SASI_Rn02_00240238 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040865 predicted 472
2 SASI_Mm02_00325432 predicted 420
3 SASI_Mm01_00040868 predicted 475
4 SASI_Mm01_00040869 predicted 471
5 SASI_Mm02_00325433 predicted 374
6 SASI_Mm01_00040872 predicted 294
7 SASI_Mm02_00325434 predicted 378
8 SASI_Mm01_00040866 predicted 460
9 SASI_Mm02_00325435 predicted 292
10 SASI_Mm02_00325436 predicted 294
11 SASI_Mm01_00040864 predicted 238
12 SASI_Mm01_00040867 predicted 242
13 SASI_Mm01_00040870 predicted 536
14 SASI_Mm01_00040871 predicted 544
15 SASI_Mm01_00040873 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016558
VALIDATED
SCAND1 MISSION shRNA Bacterial Glycerol Stock
SCAN domain containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-633s1c1
Sequence:CCGGGCGGCCTGACATCCGCACCAACTCGAGTTGGTGCGGATGTCAGGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016558.2-389s1c1
Sequence:CCGGCGGTCCCTGAAGCCATCCCTACTCGAGTAGGGATGGCTTCAGGGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-534s1c1
Sequence:CCGGCGAGACGTTCCGCCAGCGTTTCTCGAGAAACGCTGGCGGAACGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-734s1c1
Sequence:CCGGGCCGCACGGATGTGCGCATCACTCGAGTGATGCGCACATCCGTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-664s21c1
Sequence:CCGGGTGGAGATGCTGGTGCAAGAGCTCGAGCTCTTGCACCAGCATCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-639s21c1
Sequence:CCGGTGACATCCGCACCAAGGAGCACTCGAGTGCTCCTTGGTGCGGATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-482s21c1
Sequence:CCGGCCGAAGCTGAAGCGCGCTCCACTCGAGTGGAGCGCGCTTCAGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-317s21c1
Sequence:CCGGAGCGTAACTGTGTGGGCTCCTCTCGAGAGGAGCCCACACAGTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-742s21c1
Sequence:CCGGGATGTGCGCATCACTGGCTGACTCGAGTCAGCCAGTGATGCGCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-552s21c1
Sequence:CCGGTTTCCGGCAGTTCCGCTACCACTCGAGTGGTAGCGGAACTGCCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-681s21c1
Sequence:CCGGAGAGCAGCTGCTCGCCATCCTCTCGAGAGGATGGCGAGCAGCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-281s21c1
Sequence:CCGGAGAAACTGGAAGGAGCCGGTTCTCGAGAACCGGCTCCTTCCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-522s21c1
Sequence:CCGGTAGACTCGGTCCCGAGACGTTCTCGAGAACGTCTCGGGACCGAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-651s21c1
Sequence:CCGGCAAGGAGCAGATCGTGGAGATCTCGAGATCTCCACGATCTGCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016558
VALIDATED
SCAND1 MISSION shRNA shRNA Plasmid DNA
SCAN domain containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-633s1c1
Sequence:CCGGGCGGCCTGACATCCGCACCAACTCGAGTTGGTGCGGATGTCAGGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016558.2-389s1c1
Sequence:CCGGCGGTCCCTGAAGCCATCCCTACTCGAGTAGGGATGGCTTCAGGGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-534s1c1
Sequence:CCGGCGAGACGTTCCGCCAGCGTTTCTCGAGAAACGCTGGCGGAACGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-734s1c1
Sequence:CCGGGCCGCACGGATGTGCGCATCACTCGAGTGATGCGCACATCCGTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-664s21c1
Sequence:CCGGGTGGAGATGCTGGTGCAAGAGCTCGAGCTCTTGCACCAGCATCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-639s21c1
Sequence:CCGGTGACATCCGCACCAAGGAGCACTCGAGTGCTCCTTGGTGCGGATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-482s21c1
Sequence:CCGGCCGAAGCTGAAGCGCGCTCCACTCGAGTGGAGCGCGCTTCAGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-317s21c1
Sequence:CCGGAGCGTAACTGTGTGGGCTCCTCTCGAGAGGAGCCCACACAGTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-742s21c1
Sequence:CCGGGATGTGCGCATCACTGGCTGACTCGAGTCAGCCAGTGATGCGCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-552s21c1
Sequence:CCGGTTTCCGGCAGTTCCGCTACCACTCGAGTGGTAGCGGAACTGCCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-681s21c1
Sequence:CCGGAGAGCAGCTGCTCGCCATCCTCTCGAGAGGATGGCGAGCAGCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-281s21c1
Sequence:CCGGAGAAACTGGAAGGAGCCGGTTCTCGAGAACCGGCTCCTTCCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-522s21c1
Sequence:CCGGTAGACTCGGTCCCGAGACGTTCTCGAGAACGTCTCGGGACCGAGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-651s21c1
Sequence:CCGGCAAGGAGCAGATCGTGGAGATCTCGAGATCTCCACGATCTGCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016558
VALIDATED
SCAND1 MISSION shRNA Lentiviral Transduction Particles
SCAN domain containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-633s1c1
Sequence:CCGGGCGGCCTGACATCCGCACCAACTCGAGTTGGTGCGGATGTCAGGCCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016558.2-389s1c1
Sequence:CCGGCGGTCCCTGAAGCCATCCCTACTCGAGTAGGGATGGCTTCAGGGACCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-534s1c1
Sequence:CCGGCGAGACGTTCCGCCAGCGTTTCTCGAGAAACGCTGGCGGAACGTCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016558.2-734s1c1
Sequence:CCGGGCCGCACGGATGTGCGCATCACTCGAGTGATGCGCACATCCGTGCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-664s21c1
Sequence:CCGGGTGGAGATGCTGGTGCAAGAGCTCGAGCTCTTGCACCAGCATCTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-639s21c1
Sequence:CCGGTGACATCCGCACCAAGGAGCACTCGAGTGCTCCTTGGTGCGGATGTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000377322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-482s21c1
Sequence:CCGGCCGAAGCTGAAGCGCGCTCCACTCGAGTGGAGCGCGCTTCAGCTTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-317s21c1
Sequence:CCGGAGCGTAACTGTGTGGGCTCCTCTCGAGAGGAGCCCACACAGTTACGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-742s21c1
Sequence:CCGGGATGTGCGCATCACTGGCTGACTCGAGTCAGCCAGTGATGCGCACATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000369511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-552s21c1
Sequence:CCGGTTTCCGGCAGTTCCGCTACCACTCGAGTGGTAGCGGAACTGCCGGAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000369449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-681s21c1
Sequence:CCGGAGAGCAGCTGCTCGCCATCCTCTCGAGAGGATGGCGAGCAGCTGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-281s21c1
Sequence:CCGGAGAAACTGGAAGGAGCCGGTTCTCGAGAACCGGCTCCTTCCAGTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-522s21c1
Sequence:CCGGTAGACTCGGTCCCGAGACGTTCTCGAGAACGTCTCGGGACCGAGTCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000257137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016558.2-651s21c1
Sequence:CCGGCAAGGAGCAGATCGTGGAGATCTCGAGATCTCCACGATCTGCTCCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020255
SCAND1 MISSION shRNA Bacterial Glycerol Stock
SCAN domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-607s21c1
Sequence:CCGGAGCAGCTGCAGGCCATTCTACCTCGAGGTAGAATGGCCTGCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-561s21c1
Sequence:CCGGCCGGACATCCGCACCAAGGAGCTCGAGCTCCTTGGTGCGGATGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-476s21c1
Sequence:CCGGCTTCCGGCAGTTTCGCTACCACTCGAGTGGTAGCGAAACTGCCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-575s21c1
Sequence:CCGGCAAGGAGCAGATCGTGGAGATCTCGAGATCTCCACGATCTGCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020255
SCAND1 MISSION shRNA shRNA Plasmid DNA
SCAN domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-607s21c1
Sequence:CCGGAGCAGCTGCAGGCCATTCTACCTCGAGGTAGAATGGCCTGCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-561s21c1
Sequence:CCGGCCGGACATCCGCACCAAGGAGCTCGAGCTCCTTGGTGCGGATGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-476s21c1
Sequence:CCGGCTTCCGGCAGTTTCGCTACCACTCGAGTGGTAGCGAAACTGCCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-575s21c1
Sequence:CCGGCAAGGAGCAGATCGTGGAGATCTCGAGATCTCCACGATCTGCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020255
SCAND1 MISSION shRNA Lentiviral Transduction Particles
SCAN domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-607s21c1
Sequence:CCGGAGCAGCTGCAGGCCATTCTACCTCGAGGTAGAATGGCCTGCAGCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-561s21c1
Sequence:CCGGCCGGACATCCGCACCAAGGAGCTCGAGCTCCTTGGTGCGGATGTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-476s21c1
Sequence:CCGGCTTCCGGCAGTTTCGCTACCACTCGAGTGGTAGCGAAACTGCCGGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000257136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020255.3-575s21c1
Sequence:CCGGCAAGGAGCAGATCGTGGAGATCTCGAGATCTCCACGATCTGCTCCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???