EMAIL THIS PAGE TO A FRIEND

SCFD1

sec1 family domain containing 1

69 Gene Product Result for
Synonyms: C14orf163 RA410 SLY1 SLY1P STXBP1L2
Gene ID:
Mouse(76983) Sec1 family domain containing 1
Rat(54350) sec1 family domain containing 1
cow(100140328) sec1 family domain containing 1
sheep(101115160) sec1 family domain containing 1
domestic guinea pig(100722415) sec1 family domain containing 1
naked mole-rat(101703930) sec1 family domain containing 1
chicken(423307) sec1 family domain containing 1
dog(480281) sec1 family domain containing 1
Horse(100050005) sec1 family domain containing 1
domestic cat(101080799) sec1 family domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003579 Anti-SCFD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701484 Anti-SCFD1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2103705 Anti-SCFD1, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, horse, bovine, guinea pig, dog, mouse, human, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016106 Rosetta Predictions human pricing
NM_182835 Rosetta Predictions human pricing
NM_019364 Rosetta Predictions rat pricing
NM_029825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116410 predicted 1143
2 SASI_Hs01_00116411 predicted 1473
3 SASI_Hs01_00116412 predicted 1431
4 SASI_Hs02_00348876 predicted 1033
5 SASI_Hs01_00116413 predicted 1478
6 SASI_Hs01_00116415 predicted 559
7 SASI_Hs01_00116416 predicted 1698
8 SASI_Hs01_00116417 predicted 578
9 SASI_Hs01_00116418 predicted 404
10 SASI_Hs01_00116419 predicted 1140
11 SASI_Hs01_00116414 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199106 predicted 1079
2 SASI_Hs01_00199107 predicted 1401
3 SASI_Hs01_00199108 predicted 1359
4 SASI_Hs02_00370974 predicted 963
5 SASI_Hs01_00199109 predicted 1407
6 SASI_Hs01_00199111 predicted 481
7 SASI_Hs01_00199112 predicted 1629
8 SASI_Hs01_00199113 predicted 506
9 SASI_Hs01_00199114 predicted 330
10 SASI_Hs01_00199115 predicted 1067
11 SASI_Hs01_00199110 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075715 predicted 474
2 SASI_Rn01_00075716 predicted 935
3 SASI_Rn01_00075717 predicted 758
4 SASI_Rn01_00075718 predicted 641
5 SASI_Rn01_00075719 predicted 1797
6 SASI_Rn01_00075720 predicted 850
7 SASI_Rn01_00075721 predicted 855
8 SASI_Rn01_00075722 predicted 505
9 SASI_Rn01_00075723 predicted 1682
10 SASI_Rn01_00075724 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168895 predicted 1824
2 SASI_Mm01_00168896 predicted 466
3 SASI_Mm01_00168897 predicted 472
4 SASI_Mm02_00336002 predicted 933
5 SASI_Mm02_00336003 predicted 639
6 SASI_Mm01_00168898 predicted 1791
7 SASI_Mm01_00168900 predicted 239
8 SASI_Mm01_00168901 predicted 463
9 SASI_Mm01_00168902 predicted 245
10 SASI_Mm01_00168903 predicted 261
11 SASI_Mm01_00168899 predicted 552
12 SASI_Mm01_00168904 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016106
SCFD1 MISSION shRNA Bacterial Glycerol Stock
sec1 family domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-1039s1c1
Sequence:CCGGGAATCAGTTCAGCAAGAACTACTCGAGTAGTTCTTGCTGAACTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-532s1c1
Sequence:CCGGCTTGTTTCATATCGTGCCATTCTCGAGAATGGCACGATATGAAACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016106.2-1956s1c1
Sequence:CCGGCAGAAGAACCTTACTATGATACTCGAGTATCATAGTAAGGTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-146s21c1
Sequence:CCGGCAGTATGGAAGGTACTCATTTCTCGAGAAATGAGTACCTTCCATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-1655s21c1
Sequence:CCGGATCTACCTGTTACTCGTATTTCTCGAGAAATACGAGTAACAGGTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-1081s21c1
Sequence:CCGGGATGAGGTCAAACGACTTAAACTCGAGTTTAAGTCGTTTGACCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-778s21c1
Sequence:CCGGAGCTTCCAGAGGCCCTTATTACTCGAGTAATAAGGGCCTCTGGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016106.2-1979s1c1
Sequence:CCGGCTACTTGGAATGTGGATAAATCTCGAGATTTATCCACATTCCAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-833s1c1
Sequence:CCGGCTTTACATCATACTTGGACATCTCGAGATGTCCAAGTATGATGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-1478s1c1
Sequence:CCGGGCAACCTTAATCCTTTACAATCTCGAGATTGTAAAGGATTAAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016106
SCFD1 MISSION shRNA shRNA Plasmid DNA
sec1 family domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-1039s1c1
Sequence:CCGGGAATCAGTTCAGCAAGAACTACTCGAGTAGTTCTTGCTGAACTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-532s1c1
Sequence:CCGGCTTGTTTCATATCGTGCCATTCTCGAGAATGGCACGATATGAAACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016106.2-1956s1c1
Sequence:CCGGCAGAAGAACCTTACTATGATACTCGAGTATCATAGTAAGGTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-146s21c1
Sequence:CCGGCAGTATGGAAGGTACTCATTTCTCGAGAAATGAGTACCTTCCATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-1655s21c1
Sequence:CCGGATCTACCTGTTACTCGTATTTCTCGAGAAATACGAGTAACAGGTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-1081s21c1
Sequence:CCGGGATGAGGTCAAACGACTTAAACTCGAGTTTAAGTCGTTTGACCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-778s21c1
Sequence:CCGGAGCTTCCAGAGGCCCTTATTACTCGAGTAATAAGGGCCTCTGGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016106.2-1979s1c1
Sequence:CCGGCTACTTGGAATGTGGATAAATCTCGAGATTTATCCACATTCCAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-833s1c1
Sequence:CCGGCTTTACATCATACTTGGACATCTCGAGATGTCCAAGTATGATGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-1478s1c1
Sequence:CCGGGCAACCTTAATCCTTTACAATCTCGAGATTGTAAAGGATTAAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016106
SCFD1 MISSION shRNA Lentiviral Transduction Particles
sec1 family domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-1039s1c1
Sequence:CCGGGAATCAGTTCAGCAAGAACTACTCGAGTAGTTCTTGCTGAACTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-532s1c1
Sequence:CCGGCTTGTTTCATATCGTGCCATTCTCGAGAATGGCACGATATGAAACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016106.2-1956s1c1
Sequence:CCGGCAGAAGAACCTTACTATGATACTCGAGTATCATAGTAAGGTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-146s21c1
Sequence:CCGGCAGTATGGAAGGTACTCATTTCTCGAGAAATGAGTACCTTCCATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-1655s21c1
Sequence:CCGGATCTACCTGTTACTCGTATTTCTCGAGAAATACGAGTAACAGGTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-1081s21c1
Sequence:CCGGGATGAGGTCAAACGACTTAAACTCGAGTTTAAGTCGTTTGACCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016106.2-778s21c1
Sequence:CCGGAGCTTCCAGAGGCCCTTATTACTCGAGTAATAAGGGCCTCTGGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016106.2-1979s1c1
Sequence:CCGGCTACTTGGAATGTGGATAAATCTCGAGATTTATCCACATTCCAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-833s1c1
Sequence:CCGGCTTTACATCATACTTGGACATCTCGAGATGTCCAAGTATGATGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016106.2-1478s1c1
Sequence:CCGGGCAACCTTAATCCTTTACAATCTCGAGATTGTAAAGGATTAAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029825
VALIDATED
SCFD1 MISSION shRNA Bacterial Glycerol Stock
sec1 family domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029825.1-1932s1c1
Sequence:CCGGGAAGAACCACAATGGGGTAATCTCGAGATTACCCCATTGTGGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-117s21c1
Sequence:CCGGCCAGTATGGAAGGTACTCATTCTCGAGAATGAGTACCTTCCATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-1120s1c1
Sequence:CCGGGCTTTCTGATAACACTGCTAACTCGAGTTAGCAGTGTTATCAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-119s1c1
Sequence:CCGGCCAGTATGGAAGGTACTCATTCTCGAGAATGAGTACCTTCCATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029825.1-557s1c1
Sequence:CCGGGAAACTGTTATGGACACTATTCTCGAGAATAGTGTCCATAACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-67s1c1
Sequence:CCGGGAAGCGGATGTTGAATTTCAACTCGAGTTGAAATTCAACATCCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-65s21c1
Sequence:CCGGGAAGCGGATGTTGAATTTCAACTCGAGTTGAAATTCAACATCCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029825.2-1930s21c1
Sequence:CCGGGAAGAACCACAATGGGGTAATCTCGAGATTACCCCATTGTGGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-1118s21c1
Sequence:CCGGGCTTTCTGATAACACTGCTAACTCGAGTTAGCAGTGTTATCAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029825
VALIDATED
SCFD1 MISSION shRNA shRNA Plasmid DNA
sec1 family domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029825.1-1932s1c1
Sequence:CCGGGAAGAACCACAATGGGGTAATCTCGAGATTACCCCATTGTGGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-117s21c1
Sequence:CCGGCCAGTATGGAAGGTACTCATTCTCGAGAATGAGTACCTTCCATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-1120s1c1
Sequence:CCGGGCTTTCTGATAACACTGCTAACTCGAGTTAGCAGTGTTATCAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-119s1c1
Sequence:CCGGCCAGTATGGAAGGTACTCATTCTCGAGAATGAGTACCTTCCATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029825.1-557s1c1
Sequence:CCGGGAAACTGTTATGGACACTATTCTCGAGAATAGTGTCCATAACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-67s1c1
Sequence:CCGGGAAGCGGATGTTGAATTTCAACTCGAGTTGAAATTCAACATCCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-65s21c1
Sequence:CCGGGAAGCGGATGTTGAATTTCAACTCGAGTTGAAATTCAACATCCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029825.2-1930s21c1
Sequence:CCGGGAAGAACCACAATGGGGTAATCTCGAGATTACCCCATTGTGGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-1118s21c1
Sequence:CCGGGCTTTCTGATAACACTGCTAACTCGAGTTAGCAGTGTTATCAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029825
VALIDATED
SCFD1 MISSION shRNA Lentiviral Transduction Particles
sec1 family domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029825.1-1932s1c1
Sequence:CCGGGAAGAACCACAATGGGGTAATCTCGAGATTACCCCATTGTGGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-117s21c1
Sequence:CCGGCCAGTATGGAAGGTACTCATTCTCGAGAATGAGTACCTTCCATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-1120s1c1
Sequence:CCGGGCTTTCTGATAACACTGCTAACTCGAGTTAGCAGTGTTATCAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-119s1c1
Sequence:CCGGCCAGTATGGAAGGTACTCATTCTCGAGAATGAGTACCTTCCATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029825.1-557s1c1
Sequence:CCGGGAAACTGTTATGGACACTATTCTCGAGAATAGTGTCCATAACAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029825.1-67s1c1
Sequence:CCGGGAAGCGGATGTTGAATTTCAACTCGAGTTGAAATTCAACATCCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-65s21c1
Sequence:CCGGGAAGCGGATGTTGAATTTCAACTCGAGTTGAAATTCAACATCCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029825.2-1930s21c1
Sequence:CCGGGAAGAACCACAATGGGGTAATCTCGAGATTACCCCATTGTGGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029825.2-1118s21c1
Sequence:CCGGGCTTTCTGATAACACTGCTAACTCGAGTTAGCAGTGTTATCAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)