EMAIL THIS PAGE TO A FRIEND

SCG5

secretogranin V (7B2 protein)

71 Gene Product Result for
Synonyms: 7B2 P7B2 SGNE1 SgV
UniProtKB ID: P05408, P01164, Q9BS38
Gene ID:
Mouse(20394) secretogranin V
Rat(25719) secretogranin V (7B2 protein)
cow(508224) secretogranin V (7B2 protein)
sheep(101102647) secretogranin V (7B2 protein)
domestic guinea pig(100731128) secretogranin V (7B2 protein)
naked mole-rat(101721672) secretogranin V (7B2 protein)
Zebrafish(393699) secretogranin V
chicken(769742) secretogranin V (7B2 protein)
domestic cat(101096484) secretogranin V (7B2 protein)
dog(478249) secretogranin V (7B2 protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003020 Rosetta Predictions human pricing
NM_013175 Rosetta Predictions rat pricing
NM_009162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209596 predicted 874
2 SASI_Hs01_00209597 predicted 719
3 SASI_Hs01_00209598 predicted 550
4 SASI_Hs01_00209599 predicted 657
5 SASI_Hs01_00209600 predicted 318
6 SASI_Hs01_00209601 predicted 643
7 SASI_Hs01_00209602 predicted 739
8 SASI_Hs01_00209603 predicted 639
9 SASI_Hs01_00209604 predicted 775
10 SASI_Hs01_00209605 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260998 predicted 856
2 SASI_Rn02_00260999 predicted 261
3 SASI_Rn01_00037076 predicted 704
4 SASI_Rn01_00037078 predicted 885
5 SASI_Rn01_00037079 predicted 674
6 SASI_Rn01_00037080 predicted 409
7 SASI_Rn01_00037081 predicted 329
8 SASI_Rn01_00037083 predicted 333
9 SASI_Rn01_00037084 predicted 262
10 SASI_Rn01_00037085 predicted 682
11 SASI_Rn01_00037077 predicted 655
12 SASI_Rn01_00037082 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075262 predicted 741
2 SASI_Mm01_00075263 predicted 949
3 SASI_Mm01_00075264 predicted 758
4 SASI_Mm01_00075265 predicted 658
5 SASI_Mm02_00315504 predicted 858
6 SASI_Mm02_00315505 predicted 670
7 SASI_Mm02_00315506 predicted 970
8 SASI_Mm02_00315507 predicted 734
9 SASI_Mm02_00315508 predicted 980
10 SASI_Mm02_00315509 predicted 743
11 SASI_Mm01_00075261 predicted 383
12 SASI_Mm01_00075266 predicted 525
13 SASI_Mm01_00075267 predicted 780
14 SASI_Mm01_00075268 predicted 441
15 SASI_Mm01_00075269 predicted 466
16 SASI_Mm01_00075270 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003020
VALIDATED
SCG5 MISSION shRNA Bacterial Glycerol Stock
secretogranin V (7B2 protein)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003020.1-322s1c1
Sequence:CCGGGACTGGAGACAACATTCCTAACTCGAGTTAGGAATGTTGTCTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-586s1c1
Sequence:CCGGACAAGGACAGAGACTGGATAACTCGAGTTATCCAGTCTCTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-158s1c1
Sequence:CCGGCTTCATGGTGTTATGGAGCAACTCGAGTTGCTCCATAACACCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-271s1c1
Sequence:CCGGACTTCAGCATTTGGGTCCTTTCTCGAGAAAGGACCCAAATGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-470s1c1
Sequence:CCGGCATCTCTTTGATCCGGAACATCTCGAGATGTTCCGGATCAAAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003020.3-802s21c1
Sequence:CCGGGGCTTATGTGCACGTGTAAATCTCGAGATTTACACGTGCACATAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-652s21c1
Sequence:CCGGCGGAGGAGTGTCAATCCATATCTCGAGATATGGATTGACACTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-734s21c1
Sequence:CCGGAGGATAAGGATCCAGAGTAAACTCGAGTTTACTCTGGATCCTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-247s21c1
Sequence:CCGGCTTCATGGTGTTATGGAGCAACTCGAGTTGCTCCATAACACCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-216s21c1
Sequence:CCGGCCGGGTCTCAGAAGCAGATATCTCGAGATATCTGCTTCTGAGACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003020
VALIDATED
SCG5 MISSION shRNA shRNA Plasmid DNA
secretogranin V (7B2 protein)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003020.1-322s1c1
Sequence:CCGGGACTGGAGACAACATTCCTAACTCGAGTTAGGAATGTTGTCTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-586s1c1
Sequence:CCGGACAAGGACAGAGACTGGATAACTCGAGTTATCCAGTCTCTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-158s1c1
Sequence:CCGGCTTCATGGTGTTATGGAGCAACTCGAGTTGCTCCATAACACCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-271s1c1
Sequence:CCGGACTTCAGCATTTGGGTCCTTTCTCGAGAAAGGACCCAAATGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-470s1c1
Sequence:CCGGCATCTCTTTGATCCGGAACATCTCGAGATGTTCCGGATCAAAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003020.3-802s21c1
Sequence:CCGGGGCTTATGTGCACGTGTAAATCTCGAGATTTACACGTGCACATAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-652s21c1
Sequence:CCGGCGGAGGAGTGTCAATCCATATCTCGAGATATGGATTGACACTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-734s21c1
Sequence:CCGGAGGATAAGGATCCAGAGTAAACTCGAGTTTACTCTGGATCCTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-247s21c1
Sequence:CCGGCTTCATGGTGTTATGGAGCAACTCGAGTTGCTCCATAACACCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-216s21c1
Sequence:CCGGCCGGGTCTCAGAAGCAGATATCTCGAGATATCTGCTTCTGAGACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003020
VALIDATED
SCG5 MISSION shRNA Lentiviral Transduction Particles
secretogranin V (7B2 protein)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003020.1-322s1c1
Sequence:CCGGGACTGGAGACAACATTCCTAACTCGAGTTAGGAATGTTGTCTCCAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-586s1c1
Sequence:CCGGACAAGGACAGAGACTGGATAACTCGAGTTATCCAGTCTCTGTCCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-158s1c1
Sequence:CCGGCTTCATGGTGTTATGGAGCAACTCGAGTTGCTCCATAACACCATGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-271s1c1
Sequence:CCGGACTTCAGCATTTGGGTCCTTTCTCGAGAAAGGACCCAAATGCTGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003020.1-470s1c1
Sequence:CCGGCATCTCTTTGATCCGGAACATCTCGAGATGTTCCGGATCAAAGAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003020.3-802s21c1
Sequence:CCGGGGCTTATGTGCACGTGTAAATCTCGAGATTTACACGTGCACATAAGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-652s21c1
Sequence:CCGGCGGAGGAGTGTCAATCCATATCTCGAGATATGGATTGACACTCCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-734s21c1
Sequence:CCGGAGGATAAGGATCCAGAGTAAACTCGAGTTTACTCTGGATCCTTATCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-247s21c1
Sequence:CCGGCTTCATGGTGTTATGGAGCAACTCGAGTTGCTCCATAACACCATGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003020.3-216s21c1
Sequence:CCGGCCGGGTCTCAGAAGCAGATATCTCGAGATATCTGCTTCTGAGACCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009162
SCG5 MISSION shRNA Bacterial Glycerol Stock
secretogranin V (7B2 protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009162.2-1030s1c1
Sequence:CCGGCGGATATGAAATACTCAGATTCTCGAGAATCTGAGTATTTCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-730s1c1
Sequence:CCGGGACAATGTTGTGGCAAAGAAACTCGAGTTTCTTTGCCACAACATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-199s1c1
Sequence:CCGGTGGTTGATGTTTGAGTGGAATCTCGAGATTCCACTCAAACATCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-694s1c1
Sequence:CCGGAGGAGTGTCAATCCCTATCTACTCGAGTAGATAGGGATTGACACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-463s1c1
Sequence:CCGGCCTAAGGACTTCAGTGAGGATCTCGAGATCCTCACTGAAGTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009162
SCG5 MISSION shRNA shRNA Plasmid DNA
secretogranin V (7B2 protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009162.2-1030s1c1
Sequence:CCGGCGGATATGAAATACTCAGATTCTCGAGAATCTGAGTATTTCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-730s1c1
Sequence:CCGGGACAATGTTGTGGCAAAGAAACTCGAGTTTCTTTGCCACAACATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-199s1c1
Sequence:CCGGTGGTTGATGTTTGAGTGGAATCTCGAGATTCCACTCAAACATCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-694s1c1
Sequence:CCGGAGGAGTGTCAATCCCTATCTACTCGAGTAGATAGGGATTGACACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-463s1c1
Sequence:CCGGCCTAAGGACTTCAGTGAGGATCTCGAGATCCTCACTGAAGTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009162
SCG5 MISSION shRNA Lentiviral Transduction Particles
secretogranin V (7B2 protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009162.2-1030s1c1
Sequence:CCGGCGGATATGAAATACTCAGATTCTCGAGAATCTGAGTATTTCATATCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-730s1c1
Sequence:CCGGGACAATGTTGTGGCAAAGAAACTCGAGTTTCTTTGCCACAACATTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-199s1c1
Sequence:CCGGTGGTTGATGTTTGAGTGGAATCTCGAGATTCCACTCAAACATCAACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-694s1c1
Sequence:CCGGAGGAGTGTCAATCCCTATCTACTCGAGTAGATAGGGATTGACACTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000106519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009162.2-463s1c1
Sequence:CCGGCCTAAGGACTTCAGTGAGGATCTCGAGATCCTCACTGAAGTCCTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???